Description :
From Genome Similarity Track
Location :
Scaffold_265:44016- 45468
Transcript NameFunction/comments
Phypl_g6172hypothetical protein

Sequence
1452 bases(100 bases per row)
tcgaagctgcaggtaCCGGGTGATCTTCGCGTTTAAGTCGCCCTTCAAgtacagctcgtggagatgctTGCGAATGGCGGTGGAGCCGCGCGACGTGATT
TTGCGGGCGCTGAGATAGGCTAGCACGGCTGCCTCCGCCATCTCCCCGAGCGACAGGACTTGGTCGCAGCAATCGTCAGCGCTTGAGTCCAGCATCAAAT
CGTCGGCGACGAACGGCTTCATCaaggcgacgagctgcttggcatTCGATCGCTGCCTCTTAGGCGCATCTGCCATCCACTGCGGCTCCTGCGCGTACCA
TGCGAACCACGGTAAGTCACCGACGTCCGTCTGCGCTTGGGTTTGTCTTCATCTTGGTTGGGTTTCTGCTGACGCTTTTTGTTCTTGTCTTGTGCTGGCG
TTCCGTCCACTTTAGCTTCTAGGTTGTCTACGTGCTCGTCTTGACGCTTGATGTGTGTCATTAACTAGTCAATGACACTGCGTTGATGGTCGATGATCTT
GCTCTCGTTGCTTGGTTCCTTGTGCAGTGTGGCAGTTTGTTCTTGGCTTGGCATGGTGCTTCCACAGGTGGCGAGATGTGAAGACCATGCAAGAAGCTCA
GCCACAGACGCGCCGCCATTCACAGCTGCCGACTCCAGTCGTCCGACGGCAAGCGCATCGGCGTCGAGCCTCTTCATCAGGGGGTTGTGCAAGATGAGGT
AAGCTGTGAGCACATCGGCTACTTGCTGACTCAGGTTGTACTTGGGGCTCTCCATCTTGTAGCAGGTTTTGAACAGCGAACGTTGGACACcggcgatctt
ctccttcgtctcCGCGTCAAACGGCTTCAAGTCAAGCGAATTGACTGCGGCCTTCGTGTCGTACCCGTTGAGTGCCTTACTGACCATGTGATCTTCTCTG
CTTGTGTTGAAGATGTAGTTGAACCCCTTGTTTGTTGTCGACATATTCCAGGCCCCGCGGTCAAAGATCCAGCGGTGCGTGAGGCTTTCACACCCGCTCG
CTTGCTGTGCACCACCGCGTCGAAACGAGTGCGACGTCAGCGGTTGTacaactccagcagcaggcgcgaCGCGGTTCAGCAGACGGTTGACGTGGGAGTA
TACCGtcggaacagcagcggcgggcTTCGGATCGGCAGCGGTAGTTGgggctgcagcgtcaaggGCGGCAAATTCGTCGGGGTGGTTCAGAATTTCCACC
AGCGGAGTCGCCGACGATAGCGGCTTCGACCGGGATCTCGGGCAAGTTGTCGACCAAGGCAACGGACCGAGCGGGCTGCGTGATAAGCGCCACAGCGATC
GCGTGCAGCGGGAAGGTGACGAAGTCGGCGTCTGGGAACAGCGACAACCCCTGCTCTTCGGACGTCTTCATTCGGATGAAGCGCACGAAGAACACCTCGG
CTGCGTCAACGGAGAGGTTCTGCCTGCGGACGAGCGACAGGTCTGAAGCTCG