Description :
From Genome Similarity Track
Location :
Scaffold_86:44001- 46362
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_86-snap-gene-0.31Tubulin polymerization-promoting protein family member 2

Sequence
2361 bases(100 bases per row)
GACTGATCTCAAAGAGACCGTACAGTGCAGTGATAAGTGAAAGGGGTAATAGAACGTCAAGCCTCTACTGGAGGAGAACAAACCAGGCGCCACAGCATCT
GCGTGTGGATGTGTCTGTGGTCGAAGCCATGCAGTTGGGTGCGAATCACCTTCGCCTTAGAAGGCGAATTCTGGGGCTTGCACTTTACTTCCTTATGTGT
AGGCTGTACAGCGTGACCAACAACTTCTGAAGGTTCCCATGGACTTCGATCCAGTCAGGCAACAAaGAGTTGGCCGATTTCCTCAGCTGATGTGGCATCG
ATTGCCTGTCTGATCACCTCTTCTGCTTGCAATGCAGGAAAACaCGACAGTGTATTACACAGACACACACAACAGCTCTGAATGTCCATCGAAGCCGTAT
TCCTGCAACCGACCGGGGAGGCTTGGCCACTGGCGATCAGATCCCTCGTCATCTTGGTTGCCCATTCAAGCTCGTGCCTACTGCTTCTTCAACTTACCAC
AGTTCGAGGCAGGAAGCCTTGGGATTGCGAGACATCATCATACCAATCTCACCTCCTACGTGCAACGCCGAGGTTTCAGCTCCACATCACTCTGAGCCCT
TGCTCCCCAACTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgcgtcgcgtcgCTA
CGGCTCCGTCTCTCGgCGTCGCTtgCGACAGACGACcGCCTGCCTGGACTCAAGTCACAGACACATCGAGGGCTAGCGAGATGGAGGACGACACGCAGCc
GCAGCACGTCGATGTGTATGAGCGCTTGTATGACGTGCGCTCCTACACGGGCGTATACCGTAAGCGCTTCGAgTtGGACATCCACGACCTCACCGACACG
ATCGTGCACGACCTGTCCAACGCTGTGCGGACCAACTTGAACCaCGACGTTGAGGGGAGGTCtCGTCGGGCGACACTGTGCGTAGAGTCATTGTGCGGGT
GCTTACCACACGAATGGAGGCTCAGGGCTCGATGGTGTATCTTATAGGTCTCCACGAGTGGGGTTATCGACCGCGCCTCCAGCTTCAACAGCACCTCCAT
CGACTGAGATCGTCGCGAACACGGTGAAGAAGTGGCAGTAATGGCTAAGCTGAGCGAGCGGAAACTGATTTTATGTGAAGCGACAGAGTCCAGAAGCACT
GGCGCCGGCATGTCCGAGTCCTATTCGCCTCGAGGGCGACCCGAATGACCCTCACACTTTGCTACGTGCTGTATTCCACTATTACTGCCGGTTTGGTCGT
ACAGGATCTAAAGGAGCGAACGAGACAACGATGGGTGTGTTCGAATGGTGTGTGCGGCTCGCCTGAGGATGAGGTCTGACACTTCGTGTTGGCTGAGCCA
GACAACGCCAACTTCTCCAAGCTCTGTCGCGAGTGCCCCGCCCTGGTGGATTCATCGTTCACTCGCACCGACGTCGATCTCATATTCGTCAAGGTCAAGA
AGAAGGGTGAGCGACGCATCAACTATACGCGTTTCTTAGATGCACTAGGCATGATCGCGATCCAGAAGTATCCCGACATGGTGTGGTAGAGTATTGAAAG
CGGCCACAGCGGCGACAAGACTGACTCCTTTGTGTTTTTTTCCTCAGTCGCTTGAAGCATCAGTGCCGATGCTGCTGCAGGTTCATATTGCTAAGCTACC
TTGTGTTGTCGAGTTCACAGACGGAAAGCAGGTGAGATCTTTTCGCACGCTCGACAGTTGCCCGCAGCACTAGTAACACTGATGTCTTCGTGCACGATCA
GGTCCAAGCTGTTTGGTCTCGACGCCTGGAAAGAGAGCATTCGCACACATCGTCCTCATCAGCGCCACCGTCACCTCCTACACCATCTCGTCGTGCGCCA
TCATCACGTACATCGCCACCAAAGTCGTCACATGGCTTCAAAGCTCTGCCTCCGGCGCCTTCAATGTCGCCCCGACTGATTCGTCGAGTCTCCGCACCAA
GCGAGACCCCTGTGGGCAACTCCATTCATGACTTACGACGGAGCAAATCTGAGCTCAACAG