Description :
From Genome Similarity Track
Location :
Scaffold_1545:4400- 6483
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1545-snap-gene-0.1Polyprotein

Sequence
2083 bases(100 bases per row)
CTCCCACGGCGACGGCTCCGTGGGCTGTGGCGCCGACGCCAGACTCACGACGACCGTCAGCCCTGCAGTCGGGACGCTTCGAGCGCGATGCGCCTTCTCC
TCTCGTCGACAGTTCGGGGAACATTCGTTGGATCGTCGATCGCATTGTCGATCACCGCGACGCGCGTCGTGGNNNNNNNNNNTGCGTCGAGCCTCCAAGT
CGGCGTAGTCGAGTGCCTGCTCAGCGTCGTGGCTAACCCAGCGCAGCGCGTCCTCCCACGGCGACGGCTCCGTGGGCTGTGGCGCCGACGCCAGACTCAC
GACGATCGCCAGCCCTGCAGTCGGGGCGCTTCGGGCGCGATGCGCCTTCTTCTCTTGTCGACAGTTCGAGGAACGTTCGTTGGATCCTCGATCGCATTGT
CAATCACCGCGACGCGCGTTGCGATGCGCCTTCTCAACATACGCGTGGTCCGCCGCGGTCCATCCCCAGTACGCGTGAGTACCGAGTGCGTTGGCTTGGG
TTCCCACCCACGAATGACTCGTGGGTGCCACGCGCGTCGCTTCGTGAAGATGTCCCGGACGTGGTGACGGAGTATGACGCGACTGCAACCGCGCGCGCGG
AGGCGCACGCTGTAATGGGCCCTCAATGGCCATTANNNNNNNNNNGCCGGCAGCTCGAGCGCGAGCGAGAACAGGCGACATGGCGACGGCCGCGCGAGCG
AGAGCGTGAGCGCGACCATGCGCGCGACGTCGAGCAATGGCGCTGGTCGGCAGACCGCGAACAAGAGCGTGATCGCGGTGACGAACGGTCGGACGACAGC
GACACACGTCGNNNNNNNNNNCACTGGTCGCAATCATGTGTGGAACGATGGTTCCTGCTCTTTGGGAACTGGACNNNNNNNNNNCGGTGCTCCGTGACGA
TCTCCTCCCAGCCGGCGCGATTGTGGCGCGGCACGTGATGACTGCGGCACGACGGGCAGCTGCGGAGGTAATGCGCGTAACAGCAGCGTCGATCAGCATC
CCACGACAGCGCGCACAACGCCTCGGCGAGCTCGTCAGTCCCGTGGCCGCGACGGTGGCGTTCGCGGCTCTCAACTTCAAGCTCGGCATCCGGGTCTTCG
TTCCACCGCGTCACGAACGCGGTCCACGAGATGTCGAGATCCTTCGACGAGGCACCAAAGGTAGGCTTGATCGCCTTACCGCGCGCCAGTCGCCGTCGTC
GCCAGATTTCCGCGAACTTGTCCTCGCCGGGCGAGTTCACGACGCCTCTGCAGTCGTACAGCGGCCAGCGACAGCGGTAGTCGACGTACGACGTCATTGG
TTTCTGCGCGCTCGAGTCGGCTCCAGTTGAAATCTGCANNNNNNNNNNCGCGTGACGTAGCTGATCCATCGCGCGGCGGAATCGCGCGACGAGCTTGCTC
TCCTCCTCACTCAGCGGGTGCTCCGCGACGATCTCTTCCCAGCCGGCGCGATTCGGACGCTGCACGTGATAGCTGCGGCACTACGGGCAGTCGCGGCGGT
AATACGCGTAACAGCAGCGTCGATCAGCATCCCACGACAGCGCACACAACGCCTCGGCAAGCTCGTCAGTCCCGTGGCCGCGGCGGTGGCGTTCGCGGCT
TTCAACTCCAAGCTCGGCATCTGGGTCTTCGTTCCACCGCGTCACGAACGCGGTCCACGAGATGTCGAGATCCTTCGGCGAGACACCGAAGGTAGGCTTG
ATCGCCTTACCACGCGCCAGCCGTCGTCGTCGCTAGAGTTCCACGAGCTTGTCCTCTCCGGGCGAGTTCACGACGCCGCTGCAGTCGTACAGCGGCCAGC
GCCAGCGGTAGTCGACGTACGATGTCATTGGTTTCTGCGCACTCGAGTCGGCTCCAGTTGAAATCTGCACGCGGTTGGCGATGGCGTGAGAGCGCACGCA
CCAGTTGCTGGGAGCACACACGTGGCGCGCACTCGATCGCCTGAGACAAACCGGAGATTCTCTCGCGCGGAATTCTCTCGCGATCTTTTGCTTTTGTTTT
GTCACTATTGAAATTTGCATAAGCGCGTGTATGCGCTATTTTGTGTGGGGGGTGGTGTAACGGGGCTACCGTTCACATACCAC