Description :
From Genome Similarity Track
Location :
scaffold_12:4400- 16221
Transcript NameFunction/comments
g744.t1 hypothetical protein PHYSODRAFT_309401
g745.t1 hypothetical protein PHYSODRAFT_343894
g746.t1hypothetical protein

Sequence
11821 bases(100 bases per row)
GATGGCAAACAGCAGCTGGCCCATGAAGAAGACGTACGAGTTGGGACTAGAGCACAGAGCGATGACCGTCATCCACTTGAAGAACGTCGTAGTGGCTCCG
GTACCGTAGATGGTTTGGAAACTAGTGACGAGCGGAGCCGACACATCGGCCATAGCCGCAGCTCCCGGCCCGATCAACGAGCTGAAGGTAGCGGTGCAGA
ACGACAGGATCACAAGCGTCGTGATGCACATGAAGAGCCCACGCGGGACGTTCTTCTCGGGCTCGATGGTCTCTTCACTGGCGAGCGGGAGCTCTTCGAT
GCCAAGGTAGAACCACATGGCGTACGGGATCGCCTCGATGGCGCTGCTTAGATCAGTGTACTCCCAATTTTGCTGGACGACCCACTGGTTGTAGTCCAGG
TGCGGGATGGCTGAGAAGAACATGATGAGCAACAGCAGCACGCACAGCGTCGTGGAGCACGCCTGCATTCGAAACGAAGCCTGCACGCCGTAGATGTTGA
GGCCACCAAAGAGAATGCCGAACGCGATGAAGAACACAGGTGCGAACTTCTCGTCAACGTTGAACAGCGCCTGGAGGTACGAGTAGATGGTGTAGAAGGT
CGACGAGTTCACGGCGACCACTTTAAGGGTTTCCGCTAGTCCACTGAAGAACGCCGCACGGGGCCCAATCGAGTGCAGCGCGAAGATGTAGGGACCTCCG
CCCGCTGGGATCGTTGCAGACAGCTCGGCAAGAGAGAACGACAGCGTCACGTACAGTACCGTCGTTATGGACAGCACGATCAGCATGCCATTGAAGCCGG
CGACGAGAGAGGACTGCCAGCCGTAGTATTCCCCGCTGATCACGGCCCCAATCCCCAACGCCCACAATTGCAGAGCTTTGGCGTGCTTCTGAGGAGCTTC
AAGCTTTGGTTCTTGGATGTCGAGCGACGCGCCGCTGATGCGGCTGAGGCGGGTCATCTTGAAGTGGCAGGCGACAGTGTGGCGGGATCACGGCAAGGCC
AATTGGAAAATGAGCACGAGTCTCGCCAGCGATGAAGGCGAGTGTCAGGGCGGCGACAATAGCGCGGGGAGGCGGCAGGGATAGCGCATTCTTCTCATCA
CGCCGGGACTCGAAGCTGGCTATCACGGCTCGAGGTCCCCTGCGGAGACCTTGCTTGAGGGGCCTGTTATTGGCCGAATGTAGCGCGTGGCAGATCGCGT
CACACCATCTGGTGCACTTCAAGGCGTGTCGGAGCTTCTTTTCTGAGCTCTGTAACACCGGAGGCGATCGGCGGCACAGCCATGAGCAAGGGCAGACTCG
ATGGCCGTTGCTGTCACCACTGGATGGCGCCTGTGGAAGATCGGCTTGCCAAATACTAGCGAGCACACTTTCGTCGAAGGGTCTTCTAGCAGAACTTGCA
GAAATTCTTCAAGGTCGGTCATGGAATACCAACAAGGATAACGAATTTTCGATGACTGCTGCTGCTATTCGAGTTGCAGTAAAGTTGCAGTGTTTGAACC
TCTGTTGGGAGTGTCAATGGACAATGGTTGACCCAGCACCCGTGAGGGAAGTGTTTTCTCCGACACCCGCGTTCGCTTGGACGGTTCAACAGGCTGAAAA
GGCTCCTTTCAATTGAGTATCAGTCTTACGGCATTCAGCGACTTCAAGCTTGAGTTCGGCTCCTCAAACAGAGAGGACATGGGAGCGTACGGATGACATG
GCCGGTCGTTGTTCTGGACCCGTTTAACACTGTCCGGATGGTCTTCTTCAAGTCGAAGTAGAGAGCGAAAGCATCGCCACGAAAGTCCGGTTACGAAGCT
CCAGCATTCACAGTGTGCTCAATTCTCGATAGACGGCACCATGCCGCGGCGAAATGGCAAATGCACTCGAAGACACTGAATGTTTGGTCCACCCCCTGTG
TCTACGGTGGCGTTAATTGCCGGAAGGGATGTATACGAACGCTATTTTGCTGGGTCGTCACCGCGTAACAATTTGGTTCAGCCAGTCGCACCGGCATCAT
GGTGATGATCATGCCACGCTGTTGGGGATGCGTTAAACCATTTTCGAGCGTATCATAAGCGTGCCGACCGAAGTTTGCAGTGCTGCCGATCGCCGCAATG
CTGAGATGGGGCTGAAAACTGGTTGCTGTACTTCACGGATCTTGATAGAACTAGGATCCCTTGTCCTATCGAGAGTTTTGACATCAATGACGGAGGCCGC
TTACTTTCACCCCTTGTCTGGAGTTTTTAAACGATGCAAATCAAGCGCGACTCTTTTCCGATTAAACCCTCGAAGAATGAAGTGGTAGAAGGCGTTGGAA
TCACGGGGTACAGCTCATTGGTGACACTAGTTTGCAAAAACGAAAACAACGAATTCCTGCATCGCTTTTTTTAAGCACTGTACAAAGTTACACTTCTTCT
TGAAGTAGTATCTAAGCCACAAAAATAAAAAAACTATCTCTGACCACTTCTCTAGGAAATAAATCCGAGAAATCTTGGTCATGAACCTGTGTTACCTCGA
TTTCATGGGAAGTTTGGCTCGTTGTGGATACATGGCCCGATTCAAGTTGACTAAGGTTGTCCTTATAATGACAACCGATTTTGTCGAAGGAGACCCGCTG
TTTAAGGCTGGTTCATACTATAGATCACTCGTTTCGATGAGCATGTAACTTAGTCGTTGCCTATGAATACATGTACATGTACTGCAATTTTCAGCCGCTG
GACAAACAGTCATGGCGGCGGAAACCCGAGCGTCCGTGACTAGGCGCGCGTGCAGCACTCAGCTGCCAATAGGCGTTGAACATGGCCACCATCTGGATGG
CTCCTGTACCGCCGATATCGGAGACTAATTTATGCGATGCAGGTTTTACCATGAAAATGCGTAACATCATCTGGGCTAGCTTGCAGCTCTTCATGGCGTT
TAATGGCCCAGCTGGAAAGAAGCACGGGGGCTCCACTACCGTAGATCAACCAAGCGCATGGAGGGCTCGGTTAGACGCATGGCAGCAACATCAATCGGGG
CTCTCGCTCACTTTCGGATTTGCCTCCGCCCGCTCTCGTCTCTTCCAGCGACCACGACGCCATCATGGCTCCCAGTGCTCACACAACCTCCAAGGATATC
AAGCACCCACTCGACCCCGTCACTGCTGATGAGGTCCGCACAGTGAAGCAAGTGCTAGCGGATGCCGGGTACTCGGGTCCAGAGCTACGCTACGCGTACG
TGATGCTGTTCGAACCCGACCACGCTACTTTGGACAAGTTCAATGCTGGTCAGTTGGCGGAAATCCCGCGTGAGATTGGAGCTTTGGTGCTCGATCAGAC
CACAAACGTCACGCGCGACTTCGTTGTGGACGTCGTGGCCCGCCGCATCGTCAAGGAGGTGGAGCTTGACGCCAAGACGGACGGACAGATCCCGATCCTG
GACCAGGACTATTGGGATGGCGATTCCGTTTGCAAAGCTGACCCAAATTACGTCGCAGCGCTGGCCAAGCGCGGTATCACCGACCTCGACATGGTGCGCG
GCGAACAGTTCTCGGCCGGCGTCTTCGGCTACGAGGGAGAGGCAGGCAACCGCATGATCCGCGTGCTCAGCTTCCTCAAAGTGGAGAACACACACGCAAT
GTACGGACACCCGATCGACGGCCTCGTGGCGCACGTTGATCTGACAAACCGTAAGGTTTTAAAACTAGTCGACACGGGTTACACTCACATTCCGATGGAG
TCGGGTGATTACCTCGACCCCAAGATCACCGGGCCCATGCGTACGGACATGAAGCCATTGCACATCAAGCAACCGGAAGGCGCCAGCTTTACTGTCAAGG
ACAACATCGTGTCGTGGCAAAACTGGGAGATCCGCGTCGGCTTCAACGGCCGTGAAGGCCTCACCCTGCACGATATCTCGTATAACGACCGCGGACGCAA
GCGTAAGATCCTCAACCGTGCATCAGTGTCCGAGATGGTGGTGCCGTACGGAGAGCCATCACCCACACACGACTGGCAGAACTACTTCGATGCGGGTGAG
TACCAGTTCGGTCGCCTCGCGAACTCGCTTGTTCTGGGCTGTGACTGCCTCGGTAAGATCCAGTACTTGGACGCGACAGTTGTTGATGACTTCTGTGAGC
CGTTTGTCATCAAGAACGCTATCTGTATGCACGAAGAGGACTTTGGCACCCTCTGGAAACATACCGATGTGTTGGCTTCCCCACCCACGGGAACAGTGCG
TCGCCAGCGCCGCTTTGTGGTTTCTTTCTTCGTGACGGTAGGCAACTACGACTACGGCTTCTACTGGTACTTTTACCTGGATGGCAGGATCGAGCTGGAG
TGCAAGGCCACGGGCATCGTATTCACGTCGGGCCGTCCGGAGGGCGAGTACGAGTACGCCACAGAAATGGCCCCACGTCTCGGCGCACCGTGCCATCAGC
ACCTGTTCTCTGCTCGTCTGGACGTAGCCATCGATGGTAACAAGTGCCACGTCGACGAGTTGGAGGCCAAACGCGTGCCGATCGGCCCTGAGAATCCGCA
TGGCAACGCCTTCCTGCGTACATCGACCCGACTTAAGAATGAGAGTGACGCTCAGCGTGTAGCTGCGATGGACAAGGGTCGAGTGTGGCGTATCGCTTCT
AGCGAATCAAAGAACCGCCTTGGCCGCTCTACTGGCTACGCGCTCATGCCGGAAGGCCAACCGATTCTCCTCGCTGCGGACGGATCGTCCATCTGGAAAC
GCGCCAACTTTTCCACCAAGCACCTGTGGGTCACCAAGTATGCGCGCGATGAGCTGTGGGCTGCGGGCTACACCCCCAACCAGCACCCAGGTTTTGCCGG
TCTGCCCAGCTACGTGAAGGACAACCGCCAAGTCGACGGCGAGGACATCGTGGTGTGGCACACGTTCGGCCTCACACATTTCCCCCGCGTCGAGGACTGG
CCCATGATGCCCGTGGACTACGCCGGCTTCAAGATGATCCCGGAAGGTTTCTTCGACCGCAACCCGACACTGGATGTGCCCGAGGACCCGAACGGCAAGG
CCAGCTCCGACCTGCACGGGTGCTGCCACGCTGCCACGGAGCCCGTGGCGGAGCCATAACCTTAGTCAGCGTAAACGTTAAGTGGTCTCGAAAATAATTT
ACCTCAGTTAACTCAAACCTTAACGTTCAAAACTTGACTTGTCTCTCTAATATGTTGCGTAAAATCCCCCAAATATCACCTTTAGCCCTATTTCCTTATG
CTTATATCGCGATCGCGCGCTCTCTACATGCGCGTCTCCGCCTCGAAGTTAAAGCTAGTACGTTCGCGAACCTGTCTTTCGTCTTTGTGCCAAGTTTCGC
CGCCAAAATCGCATTGGTTGGTGCTCAGAATGCTACTGCTAGAATTGCGTGAATCCGCTCGATGGGGAAAATCTTATATATTTGATGAAGTCATATAGTA
TCATAAGTAGCAGGTAGCAGAGACCTTCGCGAAAAAGTGGTCTGATGCAAATCTGATCCGAAATGGAGGACGCTGGGCCTGCGTCGGACGGCTCTCTTCC
TGTGGCTGTAGACGCGTCAACTGGTTCCGAGACCGCCCCTACGCCGCAGCAGCAGCCGAATTGTGAGGCGACCGAGAATCCCGATGCTGCGGCTTTATTA
GCTGCCGCCGCAAGCGCGCCGGACCTGCGTCGTTCCTCGTCTTCCAGCAGCACAGTTACCTCTCGTGGAGTAGGCCTCGGGCTTAGCGCAGGCATCGGGC
GGCGCAGCAGAAGCCGCAGTGGTGGTGACGATAGCGACCGCGCGTCCTCGGAGCTGGTGCTGCAGCTCCAGAAGCTCTGCATACGCCAGAGACAGCGTCC
CGAAGAGCGCTCTTTCGTGCGAGGTGTGGAACGCGTACTGACGCTGCTGCGAGCGCAGGCGTCGTCTTCCACAGACACAGGAGTGACGTCCGCTACATTT
CCCGGCCCTGGACTCTCTCTGATGGACGGGGAGGCTCTAGGCAGCGTACAGGAGGAACTCGAAGCTGTTGGAGTGGACAGACGTAGCTCAGTCGCGAGCA
GCAGCTCCACTTTCAGTAGCTTTAGCTCTATGAGCTCCAGTGACAGGCTGCAGATGTCGAAAGTGACGCTGACGCTCGCGGAGATCGACGCGTTGCTGGA
TTGCATCGCAGACCTATTCGACCACCGCAATCCAAGCGTCCGTGCATTGGCATTTGAAGTGGTGCAGCTGTGCTTGCTGCGCTTTGGAGAAAGACTGACA
CCCGCGCTGAGGAGGAAGATCTATCTTCGACTGGAGACACACCCGCCTGGAGACTTTTTGCTGCAGCAGAAGGCTCTTCGGGCGCTGACGCAGGATGGAC
GTCATTTGGAGCCTTTCCACGTCGAGCTTGGCTGGTTCTTGCTGCGGTTATTGGAGCAATCGGACGCTCAGCGTGACCTGCTGGGACTCATTCAGAGTAT
TTTGCGGCGCAGTCCGCGAGCACTGGACCGTGACAAGGTGATCGCTATTGTGTCGGTTATCAGTGCGCGGTGTGATATGGCGTGGAGTCGCAATGACTTG
GACGCGTGCCGCAGGTTTGTCGCCTTTTTTCATGTGCTGGCTGCGCATGATTTAGCCTTTGCGGCTAGTACCCCGGCGTGTCTTCGGTCGCTCTGTTGCC
TTGTGAATGCTGATGGACATGGAACGTGGTCGGTGATGAAGCTGTTACTGAGTGGAAGCTCTGGTTTTCTTGTGCTTCGGGGTCTACTTCAGTTGCTAGA
GCACCCAACAGGAGCTAATTCTGCGTGGGTTCTTCGAGGCGCTGTATTTTTTGTGGGAATGTCTTGCTGGGGCTCTCAACGAGTGGCTAAGTTTGACGAC
ATTGCATGGGCTCCTATCTTACTGGCGCTTGATCAGGCCCTGCAATGTTGCCGTGGAGTAGTCATATTCGAGGTTATCTTGTCCATTCAGCGCCTGATTA
AGAAGTTTGGCGCAGCTCACCCATCCAATAGTGCTACGGATGGGTCAGCCAAGTCGTTATCACATCCAGCAGACAATATCCACGAGACAGATACAGCGAG
TGGTACCAGCACGTCGAGCTCAAACAGTAACCGGGAGAAGCGACGCCTGGTCATGGAATGGGATGTCATTTTACGTATGCTGCAAGCTCTGAGACCGTGG
GTATCTATGACTGATGAAAGTGAAATTGAAGAAGCTCCCCAGCGAGTTAACCATACAGAAACTCGAAGATCAGACACAAAAGTGCATCGTGCGGCAGCTA
TTCACCCAGATAACGAGGTGGCCGACCAGCCGCAACACCAACTTTCAGTGTCAATCCAACAAACGCGAATTCCACGTGAACTTCTTGATACTCTTCAAGC
CGTGGAAGATCTTGTGGAACAGAAGCAATTTGCTGGAGATGTGGGCGAGTTTCTTAATATTCTGGAAGAGTACTTGCCACATCTCAGTGAGAACTCGATG
ATGTTTTTGTTGCGACAACGAGCTGAAGCTGCCCATCCTGGATATCACCTCGACTGGTTGTCGACCTTGTCAGCTGCGATGCGAATCTTCTTCTCGAGCG
TTAGTCCTGATGGTAATTCACTTCCTATGCCAAGTACAGTACGATTGGAGGCTCTTGAGGTATTACGTGTCAATCTGTGGACAAGTCGCAATGTCTGCGA
AGATCGCGTGATTGAAGAAGTAGTGATCCCGACGCTTGGACGGGTATACGAAGACAACGACCCAGAGGTACGCCGGCGTGCTCTCGGCTTTATAATTGAA
GTTGCACGGCAGTTAGAAAGTGTGAAGTTCGACTCGCTGCTGGACATCTTGGCCAGTGCGATGACACTGTCAAGTTACGAAGACGCTCAGCTCGTAGCTG
CTTCAGGCATCGTTGCTCTTTTCTCGTCAGCATTTGATCATTTGCCGCCGGCCCGAGCTGTGCGCATGTATGATCTACTTGCTACGACAGTCGAAACTCA
CCGAAGCCGTGCTGTTCGACATGTTGCGCTTTCATGCCTGCTGTACGTGTGTGAAGCCCGCGCGACGGATGGGAAACTCCAGTGGAAGGAACAGCAACAT
GTGCGTACCTCGCGTTTCTTGTTTGTTTCTCGGCGTGCTGCTCGGATCAATGCGGCTGGCGTACATTTGACCGCTGCCTGTGTGCCAGTGGCTCGTGCAC
TACGCGCTCTACTAACGCTGGTGAGCGCTGAACCCGACGCAGAACTTTTCCGCATGGCTGTACAAGGTATTAAGGTTATGCTGGAAAACCGTGCCATTCT
CGAAGATGTGGATGTCGGTGAGGTTTCAGTGAAGGTCGCTGCAAGTATTGATTACCGGGCCTTTGGTCGAACCGCTATTCCCGACGAGGTCGAGAAACTT
CTTCATGAACAAACATCTAGTGAAGCAAGTGAGTCAGCGTTGGTTCCTCAAGAGCAAAAGGCACAAGACGATTGGAGACGTGTCGGACGCTCGATCCATC
TGACAGATGCGGAGCTTGTCCGCTCGATTCATGCTTCAACAAGGTCCATGAGCACTGGAGCGAGTGAGAATCCAAAAGTATCATTTTGTGCAGGCGTACA
GGCGACAGCTGCCTTACTTGCCAAAACACGGTTCCTTGCGATGGGAATCGAACTGCTGCAGCTTCTTGTTAGCTACGAAGCCGATCTGCACGATAACGTC
GTGCAAGAACTCACTCGATGCTTGATTGGCACAATGAAGCTACGATTGGCTGTTGCTGAGAAGGACCTGTTTGCTAGCGGAGCTTCTGGAGATGATTCGA
CCTTATCGTCATCAGCATCTTCGCCAAATATTCTTTATCACCACGAAGAAGAAGAGTCACAGCTCAATGCAACCGACGCGTACTCCTCTGGCACACCCCT
CGGTTTTACATCTCGAGTGTTGTCACGTTTCGGAACGTCTGCTTCCCACGGCAATCTCTTCCATGCACTCTCTGGATCTGTGAGCAAGTCTTCGTTAGGG
TCAGCATCTACGCGCACCACAACAGGCCGCCCATCGCGAAAAGACAGAGCCCGGCTACAAGGTTTCCTGCGTCAACTCTTTGAATCAGAGTTTAAACTCC
TGCACACAACAACAACCGCCTTGAGTCTGTTAGCGCTGCTTGCGCCGGAGTCCGTGCTGATGCAGATTGACGAAATTCTTCAAAGTTTACGAGGGTGCGT
CACGACAGTTGATGGCGACTTTCGACCGGATGCATTCGTGGCGGTGCTGGAGCTATTGGGCACTATAGCACCAAAACTGAGTGGTGTACCAGAAGAAATC
GCGCTGCCTGCTCGAAAGGCAATGGTGGAGGCATTGCTGCTTGGGTTCGAGTACGCAAAGTCAAGGCAGCTCGCGTACCTTTCTTTTCGTCTTCTGTGCC
AAGTCATTCATCAAAGCGGCCGCAAAAACAGAATGTCACTTGCCGCCTTGGCGATGCCAACGCTACAGCAGTGTACGCGCCGCGCCAACAGTCTTCTTGC
AGAGGCGGCTGTTGATTTCTTGATGTGCTACGCGTACTCCCAGTCAGCACTCTCACCTTCAGCCCTTAGTGGACATCAGCACCGAAACGAAGTAGGTGAG
GCATCAAGTTCAGCTGACAATCAAAGGTCAAGATCGTGGGTTTACAGAAGGTCGCTGCTTACGATCACGACAAACTCACGTGGCGATGCGTCTCTTGTGA
TCCGAAGAGCGAATTGCACAAGCCGGTGGGAGCTGGATGCGTGCCACGACCTATCGATGAACTCAGCAGCTTCCTCTCTGCTTTTCTGTCCTCCTCAACG
TGATGCGTGTCGTGGGTCTACCGGAAGTTCCAGTCGCACACAACCCAACGGACGTATCCAGCAATCGACATATATGCCTAGAGCTACAAATGCTGTCGCC
CCGAAACGATCGCTCCCAGCAGAGCTCAGACCCTCGTATCCGAGTCAGTCAACTTTGCACCCGTTAAACTCCTCTTTGAAACAGCCAAGGTCTGAAGAGA
GGAGCGGCAGACCTCGTGATGGAAGTGGTATGAAAACCTATCGGGATGCGGTGGTTGACGACAAGGCACGCTCATTCCAACACTCGCCTGCTGCCACGGC
ACTTCCTCCATTACCAGCCTATGATGGAATTGGTGGGTCTCCATCGTATTATTGTGACAACGCACAGAGTAAGGTGACAAGCGAAATTGTTTTTTGTCAA
AATGGTTGGTCTAACGTCAACTGTTGTTTGTAGTGCTCCTCCAATCCTCGCAAGCTGTACATCGCTCCGTTTCGAGAAATGCTAGAAAGCATTCCAGACA
ATCAGAAGGAGACGATGGACAAGAAGGGTTACCAGGCAAACCTGTGATTCGTGCTATTCAGGAAGATGTTGAAGACGGTGACAGCGCAGAAGCTCATACA
GGAGTTTCCGACAATGACGACGGCAAAAATGGGGATGAAATGGATGAATTCTCGCTCAATGACACTACGGATCAACCACCGAGTCTTCCAGCCCTTACGC
CAAGGATACTACACTTCTCAGATAACAGTATGTCTGCTTCCATTGGACCCGCGGCAGGGGCCATACACTCCTCGTCAATGCTATCCGATGGCGACCATCG
GTACGATCCGATGTATTTGATGATGCAGCTATTCGACATCACAGTGGAATACCGTCCACAGCTGCTAAGTGACGGACCATCGCTGAAGCTAGCGCTCAAC
GTGCTAGACCGTACTCCGGAGTATGAAACGCACAAGATTGGTTTGTTATATGTTCGAGACGAGAAACAATCGTCTGAGGCTGCTATCCTGGGAAACGCAG
GTGGATCGCTACGCTACTTGCGCTTTCTACGCGGTCTTGGCACCTTTACGAAGCTGGAGGGGCTACCAGGATATTCAGGAGGACTTGACACATCAAACAA
CAGCGATGGCAAATTCGGTCTCATCTACAAGGATGAATGTTCTCAGGTACGCGCTTGCTTGCTATATTTTATTTGCGAAAACAAAAAGACTCATTGTGGT
TTTTGATTACAGGTTATGTTTCACGTGGCCACGATGATGATTCCCGAACGTGATGGCACCTCTTCGATAGACAATTTTGCGTCGATGAAGAAGAAACGCC
ACATTGGGAATGATTTTGTGCACGTCGTGTTTAAGGTATGAGCAGAGTGATTGAGCTGTTGGAGCTCGGTACTGACGATGCCTTGCTTTTGTTTGCAGGA
ATATGACGAGGACTACGACCTGCAGACACTTTCCGGCCAGTTCAACGACGTGCACATTATTATCCAGCCGCTAAATGACAATGAGTACCGGACAGAAGTA
CACGTGAAGCCAGGAATCCCGCCGTTCGGACCGCTTTACGGCAAGCAGATCATCTCTAGCTCCATTATCTCGGAAAGTGTCAGGGTCACATGTCTGAACG
CGAATCTGGCCTGCCAGGTTTTCCACCAGGAGCTTGTGGGCTTTGCCTTGAATTGTGAGGAGCGACTGAAGCAAATCAAGCAGTTGGGGCTTCGTCTTGC
TACTGCAGATGAATGGAAACTTGACGATTGAAATGTAGCCATATCTACACCACGTCACAGATTTTGGGTTTCGTATCCAAACGAAGGGACGCGAATCAAT
TTCGCGCCAGCATTGAACGATGCGACGCCAAGATGATGCTCGGGCCTTTGTTCCTTCATCTCCACTCGTTACCTCATGGCTGACGTTCCTCTTGCTGTGC
ATCGTCTCCTGCATGGCATTGGAAGTTGTGCTCGAGGTTCAACTGCCTCTGGAGCCGCCACCAGAGCACAGACAATTCCTGCTACTCTCGGGCCAAGAAC
CGGTGGACACTTTAGAAGCTTTTCGTATACGTCACAGCCAGACACTCAACTGGAGGCACAACATGCTGGTGCAGATCTGTCAGAGACCTCGAGTGGTCTG
TCGTCGTGAAGTCCCGATGGT