Description :
From Genome Similarity Track
Location :
Scaffold_2845:440- 2741
Sequence
2301 bases(100 bases per row)
TTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAAGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCT
CAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGGAGGCCGATCCACCAGGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAG
AGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGTGGCGGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCGTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGA
TTACCGTAGGTACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGAT
CCAGGTTGTCTTATCCGTCCTTATGATCCTCATCTTTGCTCCATACAACGGTAGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTC
CCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAATCAAT
ACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCC
TCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATTCAACATCCTCAGATC
CACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAATAACC
ACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAGCTGACACTTCA
TGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGACGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGG
CTCGTACCGGATTCCAACCCGGCGAGCGTCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCTTCGGTGCTTGGCTGGATCAAACCATTGGCGGA
TCTGGTTGTAGAATCCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACATGTAGAAGCAATGATCCCTGGGATGACCTTTCTT
GCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGAGATCCGCACTGCGAACACCTGATTGGCGCTGTCCCGTCCATGAGA
TCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCGGCAGTGCGGGAGTTGTCTCCAGTCTTCGCTGTACGATCGTTGGGCGCAGTGAGACAGA
CTCGGTGGTAATCCTCTGGGTCGGAGTCCGAACTGTCGGGTCCTGATTCAGTTCCTGAGTTGGGCGCTGTGACTTGGTGGACACGTCGAGCTGGAGCCGT
AGGCGTCGGAGCCTTTTGGCGATACTTACCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCG
TCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTAGCTTGGATC
CCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAACGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTA
TTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATAC
CAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATTC
A