Description :
From Genome Similarity Track
Location :
Scaffold_830:440- 2322
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_830-snap-gene-0.3Myosin

Sequence
1882 bases(100 bases per row)
ACATGAAGAACCATAAGATCCCGCAGAGTATCCTTGTGAGCGGCGAATCAGGCGCCGGCAAGACGGAGACTGTGAAGATCATGATGGAGCACCTCGCGAG
CATCTCGATCTCGAACGCTAAGAAGACGCAGGAGCTGAGCGACGCGCAAGTGAACGGCACTACGAGCGCTTNNNNNNNNNNGATTGGCCACGACACGATC
GTGCAGAAAGTGCTGAAAAGTAACCCGTTGCTCGAAGCGTTTGGTAACGCCAAGACGATTCGCAATGACAACTCGTCGCGCTTCGGAAAGTTCACGCAGC
TGCAGTTCAACACAGACTACTGCCTGATCGGCGCCGAGTGCCGCCACTACCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAAATCGCGCG
TGATCGCTCAGGCAGCAGGAGAGCGCAATTACCACGTGTTCTACCAGCTCGTGAGTGCAAGGGAGGAGCGATATGGCTTTAGTCCAACCTCGTCGGCGGC
AGAATTTCGATACCTGCAAGACGAACCGCTTCTGCTGGACGGCCAGACGGATCTCGAGCGGTATCAGGTCACCCGAGACGCCTTGACGACCATCGGTCTC
AGCGACACCGAACAGGACGACTTGTTCCATGCGCTGTGCGGTATCCTGCGCCTCGGTCAACTCGATTTTGTGCCTCTCGAGTCCAACAAGAACGACGCAA
GCCAGCCGATGGCGTCACTCAACCCATCCGCGTTTGCAGACAACGCAATGTATCAGTCTGAGATTGAGAACCAGAAGCGAGAGATTGAGCAGTGCGCGAA
ATTGCTGGGCGTGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGCGTCAGGAAGTGTACTGTGTCCC
GTTGTCCAACCTTCAAGCAAGCAACAATCGCGATGCGCTCGCCAAGGAGGTGTACGCGCGCGTGTTCGCGTACTTGGTGCGTCGTGTGAACTACAGTATC
TCCGAGTCGCCGTTTGGCTCGGCTACGGCGCCGTCGTACATGCACATCGATCTGCTCGATATCTTTGGCTTTGAGTCGTTCCAGCGCAACAGCTTTGAGC
AGTTTTGCATCAACTTTGCCAACGAAAAGCTGCAGCAAAAGTTCACGCTGGACGTGTTCAAGACGGTCCAAGAGGAATACCAACAGGAAGAGATCCAGTG
GGAGTTCATCACCTACCGCGATAACCAAGATATGCTGGACCTGCTCGAGAATTCGATGGGTCTGATGGCACTGCTAAACGAAGAATGCGTGCGTCCGAAG
GGTAGTGACGTGTCGTTCGCATCCAAGATCGTCTCGTTGCACGAAGCGAACCCTCGACTTGAGAAAGCGCGCCTCAGTCAGACACACTTTGTGCTGCATC
ATTATGCTGGCGCCGTGACGTACGATGCTGCAGGCTTCGTGGAAAAGAACAAGGATTCGCTGCAGAGTGACTTGTTGGAGCTCTTGGCGACCAGCTCCAA
CGGGCTGATTGCGATGATGTTTGGTGCGCGAGCAAGCACGGCGTATCTCACCGACGACGACCTTGCAGCTGCGCATGCTGCATCCATGATGGACGATGGG
GGTCGACGCAGTACTTTGGGACGCAAGACGTCAAGCTTCATGCAAGAGACTGTGAGCTACAAGTTCAAGGCTCAGCTGGCGCTGCTAATGAGCGACATTT
CGAGTACCGAGGTTCACTACGTTCGCTGTATCAAGCCCAACTCGAAAAAGAGTCCGCATGTGTACGAGATCGACTCGGTGGTGAACCAACTGCGCTGTGC
TGGTGTCGTTGAAGCGATTCGCATCACACGTGCTGCGTTCCCGAACAAGATGGCTCACGAGAAATTTCTGCGACGCTTTGTG