Description :
From Genome Similarity Track
Location :
Scaffold_1357:44- 7652
Transcript NameFunction/comments
Phyta_totarag12788hypothetical protein
Phyta_totarag12789hypothetical protein
Phyta_totarag12790reverse transcriptase
Phyta_totarag12791hypothetical protein

Sequence
7608 bases(100 bases per row)
ctgacgaattgtgtgttctgcaatgGTCACTGCAACGTCTGTGCGGTTGGTTCTCGTTCGCCTTCCGTGTCGCCGGCAACTCCCGTAAACATTTCAAGTC
CTGACAGTCCGGTTCCGCCGGTTGATGCTCTCGTagccgacgccgacgctcGGGTTCTACGTTCCCGTCTCGAGCTGTCGACGGCGTTGAACGCCGGTTT
AACGGTTCACACGGCCGTTCTCCACGACCGCaacctcgtccttcttcgccgagcGCGAGAGGGGTTCGAGATGGGCTTGGCGACTGTGGCAGAATTGCAC
GGTCGGCTGGTTCATCTGCAAGCCGAGGACGCCCGACTCCACGGCGAGATGGTTGTGCTTCGGGCCCAGGCCGGTCGTTCCGACTCCCTGGAAATGCGCT
ATTCCACGCTCGAGAAGGCAACTACGGAGGAGACTCACGCAATACTGGACGGGCTCGCTCGAGAGCGAGCGCgcgtcgaggagctgtcggCGAAGCTAGC
GGTGGCTACCACTATGCCAGATGATTCCGTGGCGCCTCCGTCGCAGCTTTTGGCGATTCAGGACGAACTCACTGCTGTTCAGGCGGAGCTCTCAGACACA
GGCTGAACTTGCATGAACACAGGCGCGGCTTTCGGCCACCTGTTCCGAACGCGACCAAGCGCTGCGCATTTCAGCTGCGAACGTCCGGCACCGCGACGCG
GTAGTCGAGGATTTACGCGTGGCTCGCCAGGCCCTTCGGCAGAGTCGCCGGGAGCGACATTGGCCCGCGCGCTCAACACACCGCTCCAGGAAGACCTACG
CCGAGTGAATGCTCTGTTAATCGCCCACACCGAGGAGCATCAGCGTGACGTTGCTCGAGTTCGTTATCTGAGGCTTCGGTATCCGTTGCAGAGTCTGCCT
GTGCGACCGCGCAAGCTGAGCTTGCTGGGGCGCGAGCGGAAAAGCTTCGCGCGTCCTCGCGTTCGGTTCATTATCGCTCTAGCATTGTGGACGCACGTCG
TGCTGCCTCCCGTCTGCAGGAAGCATCGGACGCCCGCGTTCACCGGTTAGGCGGCCACGCCATCGAGTTAGAGCGTCAGCTTGCGCAGTCAGAACGAGAA
CGTGTCGAACGGGCGATGGTTTGGCGACGTTTGTTACGAGATGCCCGGCTGAGCCGCTAGTCAACTCATCGAGTGATGCACTGGCCGCCCGTTTGGTTCT
ATGGTCGTACAGGCGGGTGACACTATAGACATAACAGGGCTGATTCGGACTCTCGAGTCACAAATGGAGGTGGCCGTCAACGCTACTTTTCCTCAGCCTC
CTGATGACCTCGAACTGGCGTGTGAAGACGAAGTCGTTCCGGCCGACGGCGCTGAGCTTTCTCAGTCCACGCACGTGGCCCTGGCTTCCGTGCCTCCGAG
TGCAACTCCATCTACGGCAGCGCAGCCTGCAGTTAGGTCCGTATCGCGTGCTACCTCGACTCCTGTGTCTCGTTCGGCTACTTCCTCGgcaccatcttct
ccttctcccGCTGTTGCGTCGAGGCGGTCCCGGTCGACCGCGACGTCACCACCCTCTCGCCGACCTTGCTCAAGGCCAGTAGATCCATCGCCCCCGCTTC
AGCCGCCAACCGCTTCTGCTTCGGTTACGTCGTCGATGGGCTCTCCgtcaccacgtcgctgagTACTCGTTCGTCTACTGTGACCGATACCGCGGCGTCC
GACAGTGTTGCCGCTTCCAGTGTCCGCCGTCCTTCGTCGGCCCCGACTCATGCCGGTGTGTCGAGATCTCGGCGACGCGTCGCCCTGTCCAACAGGTCGT
CTTCGGATAGCGGATCGAGGGGGCGCACCCGGCGAACGAAGCGTCGTCGACTACGACGGCATTTctctcgttcgtcttcgtcatcatcggCGGGCCCAGA
CACGGCCAGTCCATCTCGCGGCGGCTCCAGCCGTGGTGCGTTCTCCTCATCGCCTTCTGGCTCGGCGTCGCCTTCTCCGGCTTCGCCGGGTGGCTCGCGT
CGTGCCATTCTTCTCACCCATGATCCCGCCCGTGCAGGATCGATCTGAGTGGGGTTGTTCTCGCTATGAGCCGTGGTCGGCGTCAATCGGGTAACTAACC
CTGACGTCGATCCCGATCCGCGCTATCCGGCGGGTGTATTTGCCCCCGCCCAACTGGATCTTCCCTTCGCCGGCGTCCCCGTACCTGCGTCCTGGAACTC
TGACTTGGTGTCGCTCGCCACTGCCGAAGCACCGTACGCCACCCGGCCCTGGGCCTACTTGACGCATCGAGTGGAGTCCCTCACGTTCGTGTCCAGAGAT
ACGTATTTTCAGCCGTTCCTGTTGCGTTACGACACGCACCTGGATCACTGGACCCAGCCGTACTGGGAGTCTACGCACGAGCTGGTCGTGCCCGGCGGCC
CGGCTTGGGATAActggcggcgtcgtcggAACTCTCGCCGGTCGCACGCGGGCGACCATTGGACGAGTGCACTGTAGCTCTTGTGTCAGCTATTTGGGCG
TGGGCTGGCGGACGTGGATCTGCTCTTGGACCCCTTGATCCTCCATTTCCCACCGGCGCGTTCGACCGTTGGCCGGTGGTATCCTGGTCTCGAGCATCAG
ACGCTGCAAGTGGCGTTGGACTAGGTCGACGCTCGCGAgccgtggcgctgcttcttccgcACTCCGCTGGTTGCGAACCAGCACTGCTCTGTGACGCGCG
ACCTCCCTGCTTACTTCATCTCGCGTCTCGACGGCAAGTTCATCGAGGAGATCTAGCTATCTTCCGTAGTGTGCATGTCGTAGTCGTAGCCCCTTAAGTC
AATACATGATGTTCGTTCGTAGCAAGTGTCCTCTCAGTCGCATCTAGATCGGTGTGGGCATCGTCAGACTTGAACCTTCGACTGTTGGCACGCACGCTAC
CCGCACGGCGCATAAGCGACGCGGTTACTCGCTCTACTTCAGGACCTCAGATGGCACTGCCCTTCCTTTCTTTCCACAATTTGCTTATGAGACGACCCTC
CGTCGTCTCATCTTCAGCCAGACTGGTTGGCCCTCCAGACTTCCCTCAACCGTTACCTCTCGCTCCGGCCATTCCGCGAGCGAAACTCTCTGCGATTCCT
CCTATCAGCAGCCGTCCTGCTGACTTCCGCCGCGCTTTCACAAGTGCTCACCCGCCAGGATCGTGCCTAGCCGTTCCTGCGTTTTCGTGCAACGGCATGG
CCTGGAACCGGTTATGTCCAGTGCGCTGCCGTAGGAAATCGTACAGCAGTCCTCCACAATTGAGATCCAGCTCATCGAACCCATGTCGTATTGGGACTCA
CTTCAAATTCACGTCGCGTCCGACCATATCGGGGGCCCCATCCCTCTCGCATGTCCCGTATCTGCTCGACCTCGAAAACGTCATCTCCCAACTGCTCAGC
TTCCCAGCTATCCTCCGGGAGgagttcttcgtcaaaaTCGAATCGTGTGTCGGCAGCTACCGTTAGTCGCGCGTCGGGAAATTCCGGACGGCGTTCAGCT
TGGAGATATGTACAATcgggtacaactggtacgACGTGCCGTTCGTCTCGAGACGCGCGGTGTATGTGTTCACCATCTCAGCGACTCTGAACGGGCTGTG
TCACATGTGTGCCCGCTTGCGAGCGTACCCCGGTTTCACGCGATCCAAGTAGAGCCACACTTGTCAGCCGGCTTCGATCGGGTGTTCCGTTGCGACCTCG
TTCTGGAGTCGGGCCCTCGCGTTGACTGCGTCTTGGACTAACTCTAACGCTGGTGCTCGCGCGATCTTGTAGTGCCGCTGGATGCGTAGTCTCcagcgct
tggcctccacgTCGCGATACGACGTATTACCGGCGGCCAGGGCCGCTTCCAGCGTAGATCGCGGGTCCTAACTGTGCACGAGATAAAACGGGTCTCGTTT
CTCGTACGATCGTGTGCCGTGTTGAGCGCGAAGGTAAGCTCTCCGTGTATTCATCCCAGTCTCGCTGATCGACGTCCGCGATGTGCATCTTAATGGCTCT
CGTGATCGTTTGCACCAtgcgtcctgcagcaccgtTGGCTTGGTGCCTGTACGCGAGCGTGGCTCGCTGCCTCTGACCCATGCGTTTGCTGAATGCCTTG
AAAAAGTCGGACATGAAGCCCAGCTCACGGTCGTGTCTGatcgcttcgctcgcgcCGAATCGTCTGAAGACGGTCTCTTCGTATGCTTCCGCAACTGTCT
GCGCGGTCCGTGACGCATTCGCCTTTACGATAATGAAGCATGTAAACAGGTCGACCCACACGAGCAACTCGGTGTTGCCCTTGTAAGACACTGGCAACGA
CGGGATGTGGTCCATGGCCATGACTTGGAACGGATACGTCGCCATGATATTGCCTGGTGACTCGCCTTGGATCGTCGGTCTCCCCTTTCTGGTTTCGCAG
TCCGTGCACTCGCCCACAAAACGTTGCACGCTCCTGAAAATCCCTGCCAGTGGAAGTGGCGTCGTAGTGGCTGATACGTCCGGCCGATTCCTTGATGGCC
GCCTTCCAGACTCGCGTGGTAGTGCCTCGCGGAGCGTCTCTGGGaccaccagcttcatgaTCGTGTCGCGTTCTTCAGCCGACTCATCTCCCCTCACATG
GTAACACAGTAAgccgccttcaccttcttcataTTGGTAGaccatcttgctgcagttcttcgcCTCCCGCCTGGAGAGCTCTCCGATATCGCCGTTCAAA
TACTTCTTGAGATTCGTGATCCAcagctcttcatcttggGCGATTCGGATGCGATCTAGCCTGAGTCGCTGTACGACCAGCTCCTGAAGGACTTCTGGTG
TCTTAGCTGGGGTCGACGGGGtccatgctgcagcagaccgGGTGGTTACTGCTTGCGCTTGTGCCACCAAGGGTTTCGCGTCGGCGCGATCTACCGTCGA
CTGGTGTAAATCGGGCGTTTCTGGATCGGCTCTTCTTGATCGGACGATCTCTCCGAAACGATCAGATTTTGGATTTCCTCCGGGCTTCGGACCTCTATGC
CGCCTTGACGTTGCAACGCCTGTCCAGCCAGCATATCGACGCTCGCGTTCCAATCTCGGCGTACGTGGAAGAAGTCGTGACGGGGCCATTCTCGTAGCGC
GTTCCGGACTCGCTGCCGGAGCAGCTTCAGGCCTGGTGACTTGAAGTCCATCTCCTCTCGCACCTGTCGGATGGCGAGGTTTGAGTCTCCGCAGACGATC
AGCCTCGAGACGTTCAACCCTTCGAGGAGCGAACATCCGAGCAGCATACCTTGGTATTCCACCTCGTTGACCGTAAGATCTACCGCGTATCCTGACGCAG
CACGGAAGACTTCCCAGCCTGGTAGCTTCCAGATGATCGCGCTAAACGCTCCACATTCTCGCTTGGCGTTGGCAGATCCGTCAAGGCTCATCACGTGGAG
CTCTCCATCAGGTGTGCTCGTCGGGATTGGGATGACGGCAATTCGCGACGGACGCTTGCGCGGTGCGATCTCTTCCAGGACGGTATCCACGAAGGCTCTG
GGTGTAATGCTCACAGCTAACGCCCCAAGTATCTCTTCTCCTCCTTTCGTGGACCGGTGAAATCTCTAGCGTACATGGTGAGAGTATGGCGGCCCATTGC
GACAGTCGACCTTGTAGCCCTTTGGATCAGAACAACCACGCCAATGTCGTGTGGCAGGTCAAGCCGCGTATTGATTTCCCAGCCAGCATCGTGAATCAGT
TGTTGAGGATGCGCAGCAAGGCCAGggtctccttctcgacgatgTTATAGTTCAACTCGCTAGGCTTCAACGTGCGACTGATAAATTTCACCGGCAAGTA
CACGCCGTCGTGAGCGTGTGTGAGGGCTGCCGAGATCGCCCAGTCGCTGGTGTACACGATTACGACGAGCTCTCGGGTTGAGTTGTAATGCTTCAACATC
GGAGTCTCGGCAAACTTGGCCTTGAGGGTCTCGGATGCACGTGACCCATGCCTTCACTTCTCTTGTTCGCGGATTTCCGGTTTTGCGGCGAATTCGTCGA
AGTCGGTCTCTGTGAGCGAGTACAACGTGGTCGTGTTGATCGCGAAGTCGGCGATGAACCGGGGGGTAGTAGTTTAGACTGCCCAAGAAAGTCTGCAAAC
CTTTGACTGTACGCGGGAATTCCAAGCTCGTGAGCGACTCCAGGTTCTTAGGCTTTGCTTCCAACCCGTGCTCCGACACCTTGTGACCCAGGTAGTTAAC
CTGAGACATTCCTCACGTGCTCTTCTCCACACTGATGGACAAGTGCCATTGATCGCAGACGTCCAGCAGGCGTTCCACTTTCTCGCACAAGTCATCCCAT
GACGTACCACCGATCAAGATATCATCGACGTACGATCGACGGCCTAGAACGGAGTGGATCCCCGGAAGTTCCGGGTTTCCTCCATCGAAGACGCTCCGTG
TATCCCGATCTGGGATCAAGCTCCAGAAGCCATAGAGCGCATTGTCGATCAGTCGCTGGTATATTTGCGGCGTGTTGTACAGTCCGAACGGCATCTGCTG
CCATTCGAACAACCCAAACGGGGTGATGAACGCCGAGGTTAGTCGGGTCTGATCTGTAATGGGGACTACCTAGAATCCGCTGGCCATGTCGAGGGAGTAA
TACCACAGGTACTTGTCCAAGTCTTCCAGCAAGGCATTGACGAGCGGCATCGGATACACCATCAGCTGCGTCAGCCCGTTTACCAGTCTGTAGTCGGTGC
AGAGACGGATATCGACcccgttcttcttcataATCGTGACGATGGGCGATGCCCACGGAGAAGTCGACAAACGGGACATGCCCGCGTTGAGGAGCCCTTT
GAGCAGGTCGGAgatcttctccttgaactgAGGTGAGAGCTTACGGACGCGTTGCGCCATCGGCTTAGCGTCGCCAACGTCGATGTGACAGACGGCCCTT
GTTACTGCTGGCGGTAATGCATTGCCCTTCCCGATCAGCCATTTTCGCCGCTTCCAAATGATCTTGCGCATCCGGTCTATTCTTCCTGCGCAGCCACCAA
CGATGTGACCCAGTTGGTATTCCGATTTTGAGATCTTCGATCTTCACTTCTGCGTTCAGAGAGAGTTCTGACAGAACAGCCATTTCCCCTTCCAATTCTT
CTGCGAAGAGGTCTGATCCTTCGTGGAAGAGTACAGCGTCGTCCGCGTCAATGTCCTTGTCTGGCCCATCCTCCGCTGTATCCACTGGCACCTGATTCAG
AGGATGCATTTCTTCCACTTTCTCCCGTTGTCCCACGATGTCGCACTTCTGCGGCTCTCGCGCTGACTCTTCGCATTCAGACGTACGTGTCGGTTCTGCC
GCCGTCAATCGCACAGCCGCCACAATCGCAGCGACCGTTGGGGGCGACTTCCGCTGGCGTTCCACTGGGTCTTCCATCTTCCTTTCGCCTCGACGCGTGA
TTCCTCTGGGGATTTCGTGTGTCGGGCGCTCGGTCATCAGTCCGTCGGGTGTCCAGTCTTCGTCCGCATCGCAGGTGGATCGGTACGTGTGGTTCTGCCA
CTCTTGATAGCGTCGCGACTCCACTTGCACGAAGCCGAAGGCGCGCGGAATGGCGTCTACGGGAGTCCACCAGCCCAGCGGCGTGTGGGCGTCGAGCCTT
ATTGGCTT