Description :
From Genome Similarity Track
Location :
Scaffold_687:44- 5034
Sequence
4990 bases(100 bases per row)
CACTGAAGATGACATTATGCCGAAGTGATCGTAGGCGTGAACACAATCTAACACTTTAGGTaaaattgagaactgtattttaTTTGCCTTTTCGTAGCga
attacctcctaaaagtcataaTACGTAATAGGGGGGTGGTCGACAGACTCCTATGATTCTTATTGGGTAGAAATACGttgctttctaccaatgagatctc
taaatgtatgcggaccagtcgtccgcctcaatgtagccattggtgtgtctcacaccaaggaaggaggtaattaacttctaacCGAAACCCCTTCTGTTAc
gttacaagtgatgtagccacttatacgtgtaaccccgttacattAAGGCCAGTCACCTCCCAAATCCTTTGGCTACCGTAATTATTTTTATTGAAATTCA
CCCTTTGTAGCGACAGTCCAAAACTTCCAGCCAATTAAAATACAGTATTCTGGTCATCTATCAAGACTATTTCAAAGATACCCCAACAATAAATTACCAC
CAGTCATATTTTACAGTTGGTTTTGTCTTCCATCGATACTACATTCTCCAATTGCATGCGCACACCAGCATGCCACGTGAAGGCCACCCGCGGGTTAAAG
ACTTTGAGGCCTGCTCAACACCATACGAGCGAACTGTAGTCGACTTCCCCCGCAAGCATGCCACCCACGGCTATATCAAAACCAACGGTAGCCGTAACGC
GATTGTATTCGTCTCTCCAGGACAGGAGCGAtgcgccagctccacaaATGGTACGAAAATCGTGGCGACATTGCTGATCAAGTTGTCAGCGAGAGTTGCT
TTCACCAACTGAAGCATCAATGCGGCCGAATATTTCACTTTAATTACCGAAGCTTATAAATTATTATCATTGGTTTGGTAAATTATTGTAGGCACTTTTT
CCCTTGTAATAACCACCCTGTCGTCACAAGAAGTGGCTTTCGATAAGATATTTAAGGTATGCCATGGATCTGGCGTGGGGAACTGAATTTGTAGCAGTTC
GTCACGACGACAGATATCAGTGATGACAAGGTTACTTGGATCTGGACGTCACTCACCTTAAACCAAAAGCTAATTCTGCGGCTCTGTAGACATCAGTCCA
CGAAAGGAGAAAATCATCAGTACTTCTACAAACAAAGCATACATATGTAGAATGAAATTATCAAGCTTTTTACATTTACAGGCATTAGATTTTATTGTTA
AGAATATTGTGATTGCTGATGTTAGTACAAGTATTGTTACTTTAGATATGTTTTTTGGCGAAATAGATCGTTAATTAGAAATTAAATATAAAATTCAATA
AAACACTTTAAGTACGCTACTGCGAAATAGAACATTTATACCGTAAGCGGCGTTGCCACTGGCAACAAGAAACATACAGCTCATATTTTGAAGGGAAGAG
TATATTTGACTTAGTCAAAGGAACCCTTACGCTTTAAATCGTCCAATAGTTTATCTAAGATCTGTACGTCGTTCCGGTAAATAACCGGGGGTTCTTATCT
CACCTAACGATTTGGGGAGTCAGCCCTGATGCAGATAATATGATAAGTTGTTCTATAACAGACTCTAATAAATGCTACCACTCAATATTTTGCTATACCA
ATTGCTCGCTGAAGGATAAGAAATGACCATTGAAAGCATAGGGCAAAATAATTCGTATGGTAAGCTTAGAGATGGCATAAATATGTTGAAATGACACCAT
GTAGTTAAACCGGCTAACCGTTCTGTCACTTTCACCTGAGTTTTCTCACATGCGTTTCTGATGCTGGATACGGGTGAATGACTTTTTAGGAGCATATACA
TGTTCCACCAGATCAGGTGTCAGCGCTGTAGTGTATGAAACGTATTTGAAGTTAATACTCCATATATTTAGGAGCACGGACGAGACccttttaaaaaaaa
tagtCCATGAGCAATAAGTAAATGAGGTCAACTCGCAGCTGAAAATTCTGCAGATCTGTCCACCACACATACAGGCTCGTTAGCACCACGTATAACAAAA
TATCATTTGCGCTGGATGTGTATCAAACGTCAATAATATTAGCTTGCTTAGCATAATTTCTGAGACACAGATTTGGCGAAGTCCACAGCAAAATTTCTGC
CCATCAGTCGCCTGCCTAAGGACCCTCGCTTGGCCCGGTGATCAAACGTAATGGGCGGATATGTTGTCCTTAGCGTGGCCTCTGTATCAGGAATGTGACC
GCTGAGGCCAGAGTCTGGTTTGGAGTTTGGGATTTGTTTCTGTGACCCGAGCTGTATCGTCTGTGGAATTGTTTTGAATCTAACCTTTACTACATGAATC
AAGCGCCTGGGAGACCGCGCGTTTGCGTGTGTATAGAGAGAAGTGTGTGTGTATATGGCAGGCGCGATTAAGAGTCGAAAAGAAGGCGAAAATAGACCGA
ATAATCATTATGCTGCCCCGAAATTGGATTCAAGTATTTAAACCTCCAGGCCGATATCCTCGCAATGTACGGCCAGGTCCCACCGTGCAAGGTTCTGCCA
TCATGTTCCATTTTATCGTGCACTGGTCGAGTGTTGGCCAAGCTAACACTTGTCGAGTTGGTTTTCACCGAATTCAGTATGGGTGGTTTAGTTGAGATTC
TGCAGGATTCTttttttaaccaatcagaaGGGCGTATTTGTCCGGCAATCCGGCAAATACGACATTGCGACATCCTGCCGGATTCATATCACCCCGCAGG
CAGGCAAGGGAGGGGGGACTCGCTGCAGGATCGGGAGTGTCGAATTCTCCTTCATACAGCAGACGGTCGACTTGAGGGTCCCAGTCCAGCCGATGGCGAG
GTTGATATAAGTGGCGAAGCCTCATCTCTGCAGCCAGCAGGGCCAAGACGATCAaaaggcggcggcggcgtcgacaCATGCGCCTTATTCAGCTTCACAA
ATGGAGGGAGGGGATTTTTAAGACCGTTAGATGTCGCCCACCTCAGTGTCTCTGGCACACGGTTGTTCATAGACCAGATAACTGAGATCCGGAATCCTGC
AAGATCTCAACTAAAATTACCCACCCTCAAGGTAAACCAGAAGACCTCCCTCCAAACATGGCTAAGTTGGTGTATGGGCTAAGATTTACCCAGGGGTCGA
TGAACGCAAGTGCATTTGATTTCTTGTGTTGGTTGGGCGCCCACGAGAGACCCGTTAAAAGTCATCTTCATATGTGGCGATTTGGATTCTGACTAGTTTG
AGACCAAACCAACAAACGCCTTGATCCAGTCGTGGTTTGACTTGAAAGTATAAAGTAGAAGCTGGAACTGTCCTCGTCCAGGTTCGGACAAATTATAAGG
TAAACCGCGGCTTAACTGGCGGTCGTAAAAGAAAAAGAGGGGCTGGCGTGGCGCTGAAACCGTGTCAGATGGAGGTAAAGTAGAAGTGGTACGATCAAGG
TATGAAAAAAGAGAGTTTTGAAGCCGTGTTCGCATAAATGTTTCAAATAGAGGCGAATACGCACGTGAATGGAGGTGTGCAACGAGGAGGGAATGTTTCA
TTTGGGGAAATCGGGAGACATCTGAGATCGGAGGCAGATGGTGGGGCGGACGTACGTCTGGACGGCGCGGTATCCTTAGAAAAAAAGCAAGGCAATAGAT
CATACATGAGGGCACAGACGATTTCTAGTCTTGTTTGGGGTTTAGGCACCTAACCCAACAAGCGCTTCTCCGAAACGTGCGGTTAGAATGATATTGACTG
AGATGTGTGTTCCAGCCTCATGACTGTGTGAATGTGGATGTTCTAAGCGATGATCTCGCTGAATGCGCACCCGAGTATGCTCTCAGTCTAGAGTCCTGTT
CCGGGCACAGACAGGCAGGTGAAGCAGGGTATTATGTACCCAGAAACCATTGACGTCAACCCAAGTATACTCAAGACAAGATAAAGGCCTCGTGGGAACA
CTGACCAGAAAAATTCTAATGAAGATAGGCAGCCAAAACTACCGTCACACCGCGCATCAGGCGCCTAGGCGCTCAAAACGAATAaattttgtttttcttt
GGACATGGCACCCTCGATTTCTACGTATGGACAAATATAACGAACACCTGCTGAAAAAAAGTTGCTGAACTAAACATGCCTTCCCGCTAACCATTCCCAG
ACGCTTCACCTTTCGTAAGCCAGTTTGCCTCAAGCCATCGCAACCATTTAATCCCTACAAGCTCTGCTCTTGGCCTTCCTCCTCGGTCATTCTGAAATCT
GCCTTCCTGTCCACCATGTCTGCAGAAAAAAGCGTGTCAGCTACAGTCTCCAGTTCAAGACGAGCGTCACGTTGGCCAAGCATTTGGCGACAAGACCGTT
CAAACGAAGGCATGGAACTCAAAAGTGCCGTGCTACTCCATTGTTTCGCAGTGGGTGCTGAATTGGATAGCAACGAAGGAATCCGATGAGATAAAAAAGC
ATTCCAACTGTGTGGTCTGGCTGCAAGCTCTGCGTTCGATAAGGCAGAGTTGCACCCTCCGTTGCGGGAGCTTCTCGCTTCCAGCATCGACATGCACGAT
TGCCACCTTCGCTATCAGCACTTagtcgacgaggacgacgaccgagAGGAGCTTTGCATACACCCGCCGGTTTGGTATCTACCAGATGATGTTCGCTCCA
GTCTGTTCTGCTGGCTTCGGCACACACTAGCGAACGTGGTAGAAGACGACGTCACAGTCTTGATGAACTACATGCTAGAGCTGGACGACTTAAAGAGCTT
GTTCGACGACTGCTACTGGCAGCAACCCGAAACGGAGAAACGGACGGACGTGAGATTGAGCTTTTTGCTGCATCTCGGCTGCACTGTTGTAATATCCTGG
TGAAGACACTGAATGATGACTGCAAAGTCATATCGACGTACACGTACACTGTCGCGAGCGCTTCTCGAACAGTTTGTATTGCTCGTATCGGCCCCTACTA
TGCCTCGCAGGTGAATGGTTTGCACATTTAATAGATAAAGACCGTCCTGATTCAGCTTTCTTCTGGGTTTCTTCCTTTGACTGCAATAGA