Description :
From Genome Similarity Track
Location :
Scaffold_472:44- 1721
Transcript NameFunction/comments
g13829.t1XP_009524137.1 hypothetical protein PHYSODRAFT_490055 [Phytophthora sojae

Sequence
1677 bases(100 bases per row)
TCGAGACCTCGTTACAGTGGGCACCAAGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGC
CACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGTA
CCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGC
ACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTA
ATTCCTCGCACCTCCAGACTCCTACCGTGATCTGGAACTTCGCACAAGCGCAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGT
CTAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCT
CTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCT
CCGTCCACACGTCGTCCATTTACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAG
GCCGTTTGCTCACATCTGCGAATGCGAACATATAGTTCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAAACCAGTTTCAGTTGG
CGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCTTGCAACTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTT
GGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAACAGTAGTGAGCCGAATGGGTGAGCCCTCCACAGGCGGCGCA
TGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTG
TAGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCG
AGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCC
ACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGTCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCGTCCCGGCGA
CGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCGATAGCTGTCCCGCGGATCCTCGGAGCGCCCACCAT
CGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCCGATTTTCGCTCTCTGCGACGA