Description :
From Genome Similarity Track
Location :
Scaffold_4961:44- 1629
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4961-snap-gene-0.1Major Facilitator Superfamily (MFS)

Sequence
1585 bases(100 bases per row)
GTATTCGGTATACACTCGCTTCTGATTGGCACATGTTTCGTCCTATCATGGGGAGGTACAGTGAACAGTTTCTATCAACGTTATGAACCGGTATACAACG
TAACCGACCATCACTCTCAATTGTTCTTCCGGGAAGATCGCTTGAAGCGAAGTGTGCCTCCCTCCCATTTCCTCTAGCAGCTCACCATGGCGGACAAGAG
CAAGCAGCGCGTGCGCTGGGTCGTGCTCGTACTCTCGTGCGTGCTCATGATCGGCAACTACTACTGCTTCGACAACCCCGCGGCGCTCAAGAGCCAGCTC
CAGCAGCGCTTCAATAAATACCCCAAGCAGCGCTTCGAGTTTCTCTTTGTACGCGCTGCCGCGCGTTTCGAGCTCAACGGCATGCGATCTAACGGTGCTA
TGCGTCTCTGGTAGAATTTGCTGTACACGCTGTACTCGGNNNNNNNNNNGAGGCGATCTAACGGTGCTCTGTGTTTCTGATAGAACTTGCTGTACACGCT
GTACTCGGTGCCGAATGTCGTTCTGCCGTTTTTCGGTGGCGTGCTGGTCGACCGCTTCGGTGCGCGGCGAATGCTCGTGCTGTTCTCGTTCACGATTCTT
GTGGGCCAAGCAGTGTTTGCTCTGGGCTCCACGATGTCCAACTTTAACCTCATGCTGGTACGACTCGCATTGGCTATGAACCTCCCGTACAGTGGCCTCA
CTAAAACCGTGCGTCTGTTGACCTAACTACTGCAGGTCGGCCGAGTGATGTTTGGCTTCGGTGGCGAGAGTCTCGGCGTCGCGCAGGGCACACTCGTGGC
GTCCTGGTTCAAGCACAGCGAGTTAGGTAAGCACGATTCGATCCCTATGGATGCTGGCTTACTGATGCATATGTCTTGCGTGCAGCTCTCGCACTCGGCA
TCAACCTGAGCGTGGCGCGTCTCGGCAGTGTCATTAACAACGAACTGAGCCCGGCGGTCGCAAGCGCGTTCAACGTCTCGACGGCGCTCTGGGTCGGTGT
GGTCATGTGTATCGTGTCGTTCATCGCCGTGCTGCTGCTGCTCCCCATCGACAAGCGCGCAGAGCTGGCGGACGCACGCTTCAAGGCCCGCTCGGGACAG
ACTGACGCCGCGCAGAGCGTCAAGTTTAGCGACTTCCGCAAGTTCCGACCGGCGTTCTGGCTGCTCGCACTCAGCTGCCTCGTCGTCTACGGCTGCGTGA
TCCCGTTCAACAATGTGGCCAGCAGCCTGCTCATGGAGCGTGACTTCTTCAGGCTGCCACCCAGTGAATGCGTGCGTTGCGGTGTCGGCGCGTACGCGAA
CGAGACGACCTGCCCGACGCTCGCGCCCGCGTGCCCGCCCGTGCCTCCGTATGCGTGGCCGCTTCCAAAGCTCTCGGCCAATTGCACCATCAAGGAGCCG
AGCGACCAGGCCGACTGCTCGCACACTCCACCGTTCATTGACGAGAGCAAGATCAACTGCGACGACTATGCGTGGAAGAATGGTCCGTTCACAGACACGT
ACTGCAAGAAGAAATCCGAGGCCGCTGAGCGCGCGGCGACACCAATGAGTATCCCGTATATTATCTCGGCCGTGATCTCGCCCTT