Description :
From Genome Similarity Track
Location :
Scaffold_703:44- 1471
Sequence
1427 bases(100 bases per row)
ACCAAGCCGGTGTACAGCTTTGAAGTCAATCCGGCCCTGGCGAACGGCCAGGAAGTCGCCCAGCAGCTTGGCGTTATGCTGCGTCCAGTTCCGCTTGGAA
CCCTTGAGTGGAAAAATAACCCGGTAAACGTTCTTCTGGAGCCGATGGTCCAGCCCAAATCGCAGCAGGATCTGCAGGGTATGACCATCATGACAGCAAA
CGGACCTGTCGAAATCACCAAGCTGGCTAACTTTGAGGTTCAAAATCAGCCGGCCGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGA
ATTCACAGGGGAAGGGTGGATTAAGAGGAAGGGGTGAATGTTTATGCATAAAAAGAGACGTTTTACGTGCGAAGAGTCCTGCTTGATCTCAAGCGCGAGC
TTTCAAGAGCCCGAAGTATACGGACCCAATTGAAACTGGGTCGTTGGCGCTAGATCCGGATGAAATCCAAGCGTGGATCCAACCGGATCCGGAATCCAGC
CCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGCTCTGACTGGATTTCCCAACCGACGAGGGAATGTTACAG
ACATATTCAAGTAAGGGAGTGTGGATTATAATAGCTTATGCAAAAGGCTAGCTCGACCCAGTTTCCAGTCGCTAGTTACGGCTACGAAATGAATCCACGA
AGACTGAAACTGGGGGCGTGACGTCAAAGAGTGATGAGGATTAGGAAGTCTTGGGCTGAACGTTGAAGAACTTGCCCACTAGACGCTGGATCTGGCGTCC
TGGGTGTTGGCTCAAGTCCCCACGAAACTGGATGCGCCAAGGCTCGGCTTCGTCGATCTCTCGCAAGGCTTCCAATAGGCTCGTGGGTTCTGGGCGAAGG
AGGTTGGGATCCTCCAAGTTGGCTTGACGGGATACAGATCCTGGAAACCAAGCTACCTTACCCCCGCGTCGGGGAAGATGCAAGAAGGATGGATCCAACA
AAATATCCACGTTACACCAACCGTCCTGGATTGCCAACACGAGGATCACAAGGACACTCTTCCAAGCTCGGCCAGCATGGCTACGTCGGTTACCACGCTG
CTTGTTGAAGTTAAACAACCAGGTCGAACCCCGCAGTTGATTGCGAGAGATAGGGAATCGGTGAGTGCCTTCCCATATGGCAACCCGGTGCTTGGACACG
AAATCCCGGAACGCACGAACGAACAACCCGAGACGCCCGCGTACGTCACCCCGGAAGCTAACCGGATCCACCAGTGTAGTTGCCAGTGTATCCCACGGGG
CAGCATTTTGCAATTCTTCCACGTGAGGTCTGGTGATGAGCGAATCCACATAGCCGGCCGTCGGGATGACATCCGCTTCCCAAGGGAATATCCATTCAGC
TCGAAATGGCAGCTCAGAAAACAGGAC