Description :
From Genome Similarity Track
Location :
Scaffold_632:44- 1437
Sequence
1393 bases(100 bases per row)
TTTTCATCTAGCTCTCGAGATATCTGTCGAGTCTCTCGACAATCTCTTTTGCTGGGTCACAAGCACTTTTCACTCGTGGCAGCATCGACTATTTACTGGT
GTATATCATGGCGGCACCGGAGTGGAGGGTGTTACTGCGTTCACACCACCTCCAGTAGCATCGTACCGTTATGCAatcgagctcaagaacgagaagatga
gTATTTGGATGGAAGATCGGGCTAGCAAGAATCCAAGAACAAAGTACTTTAAGTATTCAAAGGTAGTACGAACACACATCTGCCGTCCGCAAATGCTAAC
AGtacaacaaaaagaagaagaaaaagttgTCTGTTGGTGCGAGTGTTaacgtcttcagcagcgggACGGCGACGTAGTTGACGACATCGCCAATGCTGTA
AACTACAACCGGCAGATTTTGGTCACATCGTCTTCACACGAACGTTCTTCCACTAAAGCCATCAGTCGCTTTTTTCACTCGCTTTGAGTTAATACAATGG
TCTGCGTGTACTCATACTTGAGTCCGCTATTTTTCCAACTCTTTCTGCTGGTCGCGTAGTTTCGATTCTAAAAGGCCAATTCTCTCCACGGAAACTGGAT
CCAGGTCAAACACGAACTTGCCACCCAAGTCAAGCGTAGGATACAGCTTTTCACggccagctccagtcgtaATGCACCACTTTCATCACCGCTAGTTTCC
TTTGCACGTAACTGGAATCGTCAAGACCGAAATCTAGCAAATCTTGTAAACACTTTGGACCCAAAACAAGGCGGTCTATTAGTCGTCTGATAAAGTATCG
GACTCAGGTCACAGCTCACTTTAACGTAGTCGAGGGTCGAATGGCATTCGCAGATGTCACAAATGCAGCTTGACTTATGCAACCCTTGTACTTACGACGA
AAGATTGCATAAACTTGAGAACACCTAGGAAAAATACACACTCATCATGGACACATACCATTCCTTCTTGCTGACATGGTTTTCCATCTAAAAACTCACC
TTGTTCTTGAGACCGCGGGTGGGTTTAATTTGTGTAACGCGTGACGCAGCCGTCAAAGGAGCGGCGGAGCCATACATCGTCACCTACATCGTGACTTGTT
GGAGTACTGCCTTTGTTGCCCGCAGTGACAGCCCCCGGACTGCTACCGTACTCATGCTGAACACACACGGAAAGCATTGTATGTACAGACAATACGTGGT
CTACATGACGTAGCAAAGGTAGACGGAAACTTGATGAGTGAAGGAGTGAAGGTACTTCAAGTAGTAGGAGTGATTGCTCAGGGTCCTGGTGCCTGTAGTT
TTTACTGCCCATACCTGAGAGTAATCAATGGAGTAAACAGACTAGGACGAGCTTGGTAGCTGAGTGCGCGAGAACAGAGATAGCTAAGACCAA