Description :
From Genome Similarity Track
Location :
Scaffold_2161:44- 1368
Transcript NameFunction/comments
Phypl_g14759hypothetical protein

Sequence
1324 bases(100 bases per row)
CCTCGACGTGAATCTCGCAAGAAGCACTCGCGCGGACATGGGGGCCCTTCAGACGCAGGCTCCGACCCGGAACCTAGCGATGGAAGCTCTAGTGATGGAG
ACTCCGACAGCTTGCCCGACGATGTCCCAGCGAACCAAGCGACGACCAGTACGCAgggcggcaccaccgtgATGACATTCCGGCCGTACGTGAACTCAAG
TACGCTGGAAGACTTCAACGACaaggcctcgctcgctgcgcgtcgtcgctggtgggAACGCTTCCTGAATATGGCTGCACAGGGTGGTTGGACCAACCAG
ATGAAGGcgtacgagctcaagctcaagatgtCGCCTGCCGTGCGCAATTGGCACGgacagctcaagaaggacgttCGCCGAGATGGGACCAAGCTATCCG
GAGAGTTCAAGCTTGAATACTGTACGTCGAAGGTATTGGAGGAAGAACGGTACTACATCATGGCTTAGTTCAAGAATGAATCGGCTCTGGCGTTCCTGTA
CCGCCTGAATCTGGTCGCAAGCCGGGCTGACGTCGCGTGCAGGAACTCTGAtcggcagcgcgagcagcacatcAAGAGggtcatcaagaagctcgtggat
gaACCGCTCCAGGCAACACTCGAGAGTCAGCGTTTCCGCAAGGTTTCGGATTTGGAGTACGTCCTGAAGAAACAGGCAGAGGTTCGCCAAGGTGACGGCA
GAGCCGCCCGGACTCCCCAAGCACGCGATTTCCGAGCCGACAATGTCATTCTGGATCGGTTCAAGCCGAAACGTGAGGACCGTGCGTACATTGCTCAAAG
CGAAGGAGATTCCGAGTCTGAGGAGCGTGTCCATCCCGAAGATGGTATGGAGGCGGATGGACTTGCGCCTGAACTAGTGACAACTCCGGACAAAGGCGAA
GCGAGCACCCCGAATGTGGTgcgagatggagcagtgATGACGAAGGAAAAACTCATTCACGAGGTCTACCGCGTGATGGAGAATGTAGGATGGCAGCCAA
GGCGCCCGCAGCCTACTCCAGGAACGCTTGCTCCGAGACAGCCCCAAGCATCGCCGTATCCATCTCACTTGCCGCGGAACAATCCGTGTCCCAACGAGTT
CTGTGAAGGATGTGGCAAGTGGGGTCATCGTCCTGATAATTGCTGGGCCAACCTGATTTGTGATTGGTGTCATCGTCGTGGACACCCGGCTCGCATCTGT
GAGACGAAGCCCTGCCAGAAGTGTGACCAATTTCACGAAGGACATTGCGAAGACTGGAAGGCATTCCAAGAGATCAAGAAACTGATTCGCCAAGGAGGCC
TGACTGACCTGCCAAGTCATATTC