Description :
From Genome Similarity Track
Location :
Scaffold_46:439843- 440890
Transcript NameFunction/comments
Physo_136569Aminopeptidase B (Ap-B) (Arginyl aminopeptidase) (Arginine aminopeptidase) (Cytosol aminopeptidase IV)

Sequence
1047 bases(100 bases per row)
GGTTGCAACCAAGAAGAAGTTCACTTTCGAGATGAAACAGTCCATTCCAGTGTATCTGGTGGCCATGGCGGTGGGAGATCTCGTGGAAGCGGAGGTCGGA
CCGAGATCCAGCATCTGGACGGAGCCGTGCATGATCGAGGCTGCAACGAAGGAGTTTGACGGAGTTCTTGAAGAGTACTTGGCCATCGGAGAGCGACTTT
TCGGTGACTACCTGTGGGAGCGCTATGACATGCTCGTCATGCCACCATCCTTCCCCTACGGCGGAATGGAGAACCCGCGACTGACGTTCGTGTCGCCTTG
CACCATTGCCGGCGACAAGTCACTCGTGTCGAGTGCGTTAGAAAACTGCTTGGAGGAGATGATTGTCTGTCAGAAAGGGTTTCAATGCTGATCATGTTTT
GTGCCCGCTTGCTTCTTGTAGTTGTGGCGCACGAGCTCTCTCACTCCTGGTTCGGCAATTTGGTGACAAATGCAACGTGGAGCGACTTCTTCCTGAATGA
AGGCTTCACGATGTACGCCGAGCGACGTATTACGGAAGTATCACACGGAAGGTAAGCCTTAGCATGCATGTGCTGCAGTCATGCCCCTTGGATGTGACGT
TACTCTTTCTGCTTTCAATGATAGACCGTTGAGCTGCCTCGACGCCAAGCTGGGCGAGGCATTGCTGCGTGAGGAGATCTCGTCGCTCGGCGAGCAGTCT
CCTTTGACACGACTGCGGGTCCCACTTGAAGAGGGAATCGATCCTGGTGATTGCTATAACCAGTGTGCTTACGAGAAGGGCTACGCGTTCGTCTGCTACC
TTCGAAGCCTCGTGGGGTCTGATGAGGTATCTGTTATTTATCCCATAATTCGTTTGTTCGAGGTTTGACTGATTCTGGTATCTGCTTCTTTTTGAGTAGG
TGTTCGACGACTTCCTCAAACGATACTGCGCCGAGTATCGTTTCCAGTCGATCCCGGCGGAAACCATGATCGCGTTTTTCCTTAAAAGCTTCCCTGAGCT
GGCAAATGCCGCAGGAACTGACCTTAAGGGCGACATATCGTTCAACA