Description :
From Genome Similarity Track
Location :
Scaffold_4:43984- 46863
Transcript NameFunction/comments
Phyke_g402hypothetical protein PHYSODRAFT_552333

Sequence
2879 bases(100 bases per row)
AACCTTATCATCACGAGCAAGTACACATACTACAACTTCCTGTTCGTCTTTCTCAAGATGCAGTTCAGCCGACTCGCAAACTTTTATACAACCATTGTGG
TCGCGttgtgcttcttcgacttctcgCCGGTGAGCCCTGTAGCAAGCCTCACACCACTGCTTATTGTGTTTGCGACTTCCGCGCTAAAGGACGTGAGTGA
AGACCTTCGCCGTCAGAAAGGAGACGCCCTCGTGAATACTAAGCCAGCGCACATTATCCGCCGGGATGTGCTCGATGAGGTTATTCATATTGACGGCATG
TGGCAAGATATCGAGGTGGGGGATGTACTAGTCTTGAAGGACGGTGATCCAGTGCCTGCAGACTGCATTCTGCTGGCTACGAGTCGTTCTGACGGTCGGT
GCTATGTTGAAACGGCCAACCTGGATGGCGAGACGAATCTAAAGATCCGTCAGGTAGCCAGCTGTACAAAACACTTTATGAGTGCTGAGGAGATTTTAGA
TCGTCACAAACTGGAGGTGGAATGCGACGTGCCTAATAAGGATCTGTTCTACTTTGATGGCGTGCTGAGGCTTGCGAAGACCGTTGGTGATGCGGTCGCC
GATTCAAACAGCGAAGATATGGAAACGAGTTTGACCATGGATAACCTGATTCTGCGTGGCAGCGAAAGCCGCAACGCCGAGTGGACACTTGGGCTCGTAA
TCTATTCGGGCAAAGAAACGAAAGTGTCGATGAACTCGGTTGCGGTGCCGCTGAAGCGCAGTTTTGTGGAGAAAACGTTGGATACTATGTTTGTattggt
gctgatgctgttaTTCAGTATCTCTATCGCTTGCACtcttggcaacaacaattgGAATCTAAACCTGGCTGAGGAATCCACGCCGTGGTACATCAAAGAG
GACTCGAACGGCTACATCTTCTTGAGTTACGTGATCCTATTCAATAATTTGATCCCGCTCTCGATGTATGTTACCATGGAAGGCGTGCGCTTCGTTCACG
CACGCTACATTGAAAGTGATTTGGAGATGTACGATCCCAAAACCGACACGCCGGCACAAgtgcgcaacagcaacattAACGAAGACCTCGGCCAGATTCA
GTATATTTTCTCCGACAAGACTGGCACGCTCACGTGCAACGAGATGATATTTGCGAAATGCACTATCGGGGGATTGCGTTACAATGATATCGAGGTGGAT
ACTGAAAAGCCTACGCGACCAGGAACACGGTTTAATGACGGCCGGCTGCTTGCGCGCTTGAATTCGAATCACTCGACAAAGAAGGAGATTCATGactttc
tgctgctgctcacgatTTGTAATACAGTGATTCCAGAGACCAATCCTACCTCGGTTACATCTTGCGATGACTCGACCACGGACTCGACCACGGACTCAAC
CCATTCGTCGACAGCAATCAAGTACAATGCGTCTTCCCCTGATGAGGAAGCTCTTGTGCAAGCCGCGAGTGACCTCGGTTACGTACTTGCTTCGCGTGAT
GGTCCAATCTGCAACACTATCATTCAAGGCAGACCCATGTCGTTTGAGATTCTCAACGTGCTAGAATTTAACAGTGACCGAAAGCGCATGTCGGTGATTG
TGCGAAACCCCGACGGAAGCATCGTGCTCTACTGCAAGGGTGCTGATGATATCATTTTCGATCTGTTGTCCAAGTCTCAGCCTCAAGGCGTAGCGCACGT
GACGCGTGGACATTTACAGGAATATGCGTCAGAGGGTCTTCGAACGCTGACAACCGCAATTCGACATCTTACACAGGAAGAATATGATCAGTGGAGCAAC
TTGTATAAGCAAGCAGAGTTTTCTATGGATGGACGCGCAGCGAAGATTGCGAAGATTTCAGCCATCATCGAGGTTGAACTGACGCTGCTGGGTGCAACGG
CTATTGAAGATCGTCTGCAGGATGGTGTCGAGGAGTCTATTTGCGCTCTACGCAAAGCTGGCATTAAATTCTGGGTCCTTACAGGTGACAAGAAAGAAAC
TGCGCTCAGCATTGGTATGTCATCGCATGTGATCGACGACAATATGGATGTGATTGTGCTTAATCAACGTGACAAAGGGTCACTACGCACGAGACTGGAA
GAGCTGTACGTCGACTTAGTAGACGACAAGTGGGGATCCGACGAAACCTCGTCGGCAATAAGTGTGCTATGGGAAGCCCTGAAACGCGCGGTGTTATACT
TGTGGGAATTGGTAAAACTTGCACTCATTGGGcgcgaccaagaagctgaggcCCGTAAGAAGAGGAGGCGCTTGCCACGACGTGAGCATGTTGATGTCGA
GACACCGACAGACAGCCCTGTGCACTACGACGAAGTGTACCCTTCCCTGCCCAACCGTGAAATTTCGGAGTGTAGTTTCGACCGCGGTCTGTGCGACCAC
GATTTTGAACCGAAAACCGATAATCTTGGGGGCGGGACTGGAAGTACGAGCAGCGGTGATTACATCGACGAAGAGTTAGAGTTTGCCATGGTAATTGATG
GCAAAACACTTGCTTTGGTCCTGGATGATGATATTAAGTATCTCTTCTTGGCGGTGGCTACGGAGTGTAAATCGGTGatttgctgccgttgctcaCCTGC
TCAAAAGGCATCTGTGGTCAAACTCGTCACTGAACCTACATTGATGTTCTCTCCTGGCAACATCACGCTTGCTATCGGTGACGGTGCTAACGACGTACCA
ATGATTCAAGCGGCGAACGTGGGTGTTGGTATCAGTGGCAAAGAAGGTCGGCAAGCAGTTTTATCGAGCGACTACTCGATTGCGGAGTTCCGATTTTTGA
AGCGCCTTCTCTTGGTTCACGGCAACTACAGCTACAAGAGGATTTCCAAGCTTATTTTGTTTTCGTTCATGAAGAACGT