Description :
From Genome Similarity Track
Location :
Scaffold_28:439827- 443333
Sequence
3506 bases(100 bases per row)
GAAGCAGAACTACCGCCGGTACCGAGCAGCCGACTCAGAATTGACTGCTCCATCGCCTCTAGGTCAATAGGACTCCACTCGTCGCTTCTGAACTCGACGT
CTTCAAGCAACAGAACAATCACTGGTGGCACCACTGACACTGCAGCTGCCGCTGCCACAAATTCATGACCACCGGATCGGATCGTGACACTGCTCTGGTC
GACCGAGGTCACTTGTCCATACTGAGCCTCTCCAGCTAAACTGACGGGTCGTCGGAGCAACGAGATGTGACCGGCCTGGGAAACTTCACTGGCCCGAACC
ACGTGGTCTTCGGCGACGGCATGATCCAGTTTCCCTTCGCCTCCTTCCAAGCTGCGAAACGTCACCTCCTCCGAGTCTAGCTGTAAGACCTTAGCATAAA
ACGGATGCTCTGCTTCGAACTCCACCACTTCAGGTGTCAAGTGAAGGAAGGAGCGGCTTGTAAGTCTCACCATGACCGGAGTGCTGAAGGCTGAAAGCTA
AAGCAGGAGGGCTTAAGCGGCAGACGGAGATTCTGAAACTAACGCTACGACATCTACGACTGCTCCTAGCACTTGAGCGTTGGTTTCATCTCTGCTTTCT
CTCCTCAAAAGCTATTTTCACCTTGAACTTGAAAATATCCAGGAGCTTGCTCAGAGCCAAAACGAGAAATCAAGGGTGATTTCGAGGGTAACTTAGTCTG
CAGCAACTGCGTGTTGTCTGCGACTGACAGTGAGTAATGAAGTCATGACTATTCGAAGAGACCCGAGGGTTTCTGGGAAGGACTTTCATGCGTGCGGTTG
TTGTAATTGGCTGAGGCCAATATTTGCAAACGGCGAACGACAACAGATTTCCCTGTGCCCCCGCCGCCGTGAACAAGGGTAAGCGTTTGCCTTTTCTACC
CGTTTTCGTCAATGCCCGATAATATCCTCACCAGAATTTCATACTGCTCGTTCGACAGTTCGCAGGGCCCAATCAGTGTAACCCCATCGAGCGGCCCCAA
AACACCCGCCGACGCGCGATCGGAATCTCCATCAATACCATCAAAACTATCAACTTCGTAAGTTTACAACTTTGACGCCACCTGCGCCATCGATTGGCCT
TCGTCTTCGGTTGCTGAGTCTGGTAAAAAGACCGGAAGGCCATTTCAGGGCAGGTTTCTCCAGCTGGAGAAATCTCGCCCCCCCCCCCCCCCCTCCGCCA
CCAAAAACTGCCGAAAGTGTGTGCGTGATTGCCGCGATGTCAGCACGCCACCTCGAAGACCCGGTCGCGGCACGAACTAACAATTCATAAGTATCGGTTT
CCGTTGGAAGCATTCCCTCAAACTCAGCGTCACCTCCGCCACTATCCCCGCGAGGCGGTAAACTCGGTTCAGCTCTAGGCTTCTTCCAGTAATCCACGCC
ACGGTTCCTCCAATCCGTTGCAATTCGCTCGTTCCTACTATTCCGATACCCTTTCATCATCACGTTCCGAATATGCCGGTAACGCTGTTTGTTTTGGAGC
GTAGCATCGAAACGATCCCAAGCATCACACAACTGAAGCACGCCGGAAGCATCATAAGACCAGGTGGGCCCATCCGACACCCACGGAGTAAATTCACATA
ACAGGTACCTTGCTAGAGTGTCGCGCTTTACCTCACCGTTGTCGCCGGCGACGATATTCGTCCACGTCGGAGGCGCCCCCCCCCCCCCCCCCAAGAACAG
GTGTGAGCATTTTTGCTCGGATATAACCACGGTGCGATTGGAAAAGGGGGTGCAAAGGCGAAAACGGAAACCCCACACGAGCAGGGCGACCACGACTCGG
GGCTTGACAAGCAACACTTGGCTTTCCCGGTAAAACATCTACAATGCATTCAAATTCGGCCGGTGAAAACTCTGCAAAATCCTCGCCACTGTGATAATAC
GACTGAGTATGTGCCACGAACACCACCTTTCCATCAACTGTAAACGCCCTTGCGCCGCCCCCAACACATTTAGATGACAAGGTCGGTAAAGAAAAGTCTT
CCTCGTTGGTCTAGTTCGCGAGAGCCGCAAGTTCCTCCTCGGCGGTGCGAAGAGAAGTATTTGCAGGCACCGCTACATCCTCCGGAGCCTCGCGCAGTTG
CTTTACAAACGCCAGTAAAGCGAACGGAAAGATATACCAAACGCATCGCTCGAAATGAACGAGCGGTAGCCCGTTATCGCGTACACCATTAACGCATGGG
ACCACTCATGGGCGCCGAAAAAGCTGTTCACTGTCCGGGCCGCTAAGTATTTACCAATTCGCAAGTTGGATTTCGAGTCTTCGGCCCGGCTCGGAAATTT
GTTTTCGTATTCAATAGCGCCTAGCAGGGCCGTTGCAGCGCCTTTTAACGCGATCTGATTCTTAGCCATGTAGGCCTCTTGGTATTCCTCAACCATGTCC
CCCGACGACTCGCCATTTATTACAGACGAATTTGTATGCGAGACAGTTAGCGTCGCAAGAACAAGATTGGTTTCGACAACCGAGGCATCCATTTGCGCCC
TCTTCAATTCCCATACCACCGGGCCCTCATCATGCGACCGGAAGCACTGCCCCTTTTCAGTAGAGTATCCCGCATCAATTCCCTCACAAATGTGCGGAGG
GAGGTTATGCCCTGTAACGATAGGGTATACTCCAGCCGCCATGTCTCCTACTCTCTCGCGGGTCACGATCAAGGGGCACGTACCACGATCGTGAACGCCG
GCCGGCCGGGATAAACGACACTCGTACTTGCCGCGTATTCCTTTTAAGCAAGTTGATGTGTGAGAGTGGAAATTCGTGACCGAAGCGACCTTTTGCGCGG
CCAGCAAAATACCAGCGGGGTCATCCAGAGCGTCCGGTACAGCGATTTCAAATGCCTTTGGGACACCGCCGTCGGCTTTGCAACGTTGACGCCACTCGTG
TACAGATTGGTCAAACCCCGTGCAGCACACCGATTCAAGCCAATCCGCCGCCCGGCGACAAAGCCGCTCGGAACAGGCAATTCGGGACAGCAACCCTGGT
GACAACTTGGACCCGTAAACACACATGTCAATGTGCAGGCGGCCATCAGCGTGCGGCTCGACGACAGCAGCGTGCGCAGCAACTGTTCCATATGCCCCGG
GGCACCTCTGCAAATAGTCCCTGGATATCCTGGTATCAACCGAGCGTTTACATAGAATTATGTCGTTGTATATCTGCCGCACGCGGCGCTCAAATGCGCG
AGCAACCAGGCCAGGGAAAGCGTTAGATATTATCAGCCTGCGGCGCGCACTCGATCTCACATTCTCCGGTAAATCGTTTCGGCAGCACTCCTTACGACCG
AACACGCTCGTAAGCTGATTCCTCTCATTGGCTTGTCAGAGTTGCGCGATGCGATGCAACTCAAGGTCATAATGCTCGGGAGGGGCGACCGTCACCCAAT
GCAGAGGGACCCCATAGTGCGTCCTCATTGCTCCCAATTTCGGCCGCATCGCTGCCCGTTCAAACGGCGAGAACGGGGCACACCCGCCAATCAGAGAGAG
TACCCT