Description :
From Genome Similarity Track
Location :
contig_38:439806- 445037
Transcript NameFunction/comments
g7153.t1hypothetical protein PHYSODRAFT_554409
g7154.t1hypothetical protein PHYSODRAFT_321823
g7155.t1hypothetical protein PHYSODRAFT_343735
g7156.t1U4/U6 small nuclear ribonucleoprotein Prp31

Sequence
5231 bases(100 bases per row)
TGCTGAAAACAGAACACAGGGAAGGCGTCAAAACGTCGCTCGACAGGTTGCAGACGTTGCTGAAGCTGATCCGGAACGAGCAGGACTACTATCGCGCACG
AGTACACCGCCATGTGCAGAGTGAGTTGCGACGTTGACTAATTCGTGTGAGGTTGTTGTAACTGCATCGACTAACGGCTCGTTCATTGCTATTGCTGTAT
TGCAGCGCTTGAGAGCAGCAAGTACCGTCTCGTCTACTACACGATGTTCGAACTTGCTGTGCTGGGCGCCATGTACGGTGCACAGTCCTTCCTGCTGCAC
AAGTGGTTCAGCGACCGGGGTTATCTCTCCAAGCGCCAGTGGGCATAAACTGCATGATGGCATCACGGCATAGATTAGTGGCAGCTTGTAACTACGTCTC
AGTCTATTGAAGCTGACTGACTGCAGTGATAAACTGCCAACAACCCGAGCAAAGAGCCATACTGGAGTAAAAAGCAATGGCGATAGAGATTCTCAACACC
AACATACTTTTTGAATCGTGCTTCGCTTTATTGGTCCACAGCCTCCAGCATGTTTCGCGCTCGAGCACTTCGCTAATAGTCCGAATCGTCGCTGTCGATC
TCCATCTCGTCAATAATCTCTTGGCATCGAGTTCGAAGCTCAGAGGTGCTTGCATTTCCATTAGCAGACACCGAGACTAGGAATGCTGGCCCGCCAACTC
CAGAAGTATCCTTGACCGACAGGTAAAACACCGTTCCATTGCTTGGCTGCAGTGCAGGTACGAAACGATACCGGCCCTGTTCCTCTGTGAGGATGCCCTG
GATCGGGCTCAGGTCGAGCAGCTCCCGCACTCGTGTCAACAAGAACCTATCCGACGCCACCACCACCTCAGAAGGGCCGGGAACAGCGCCCTCTTCGCCC
CTTCTCACAGCTTGGAAGCTTCCTTTCTGGAAATAAAACACTCGGAACGGTGAGCGTTTGGTGAGGGGTTGCTGTGTGCCGGGACTGATGCACTCCAGCT
CGATGAAGCCCGCGATCGGACCGACAACGTTTGGAACCGGCGCATCCACTTGCACCCGTTGCCCCGCACTGAACGACTCGACTGTCATGGAGAAGAAACT
TGCTTCTTCGTTGCCCAGTCGCGCGCTGATCTTGGTCGGGCCCAGCATGATTTGCGAGTGGTTCTGCACTTCGATCACCAGTTGACCGCGTGCGCCGTTG
AAGCCCGAGGAAATGAGCAGGTTCTGTAGCATGGCGGACTCCATCACGTCATTCATCATGCGCATCACCTGCGCGCTCTGCGATAAGCTCTGCCCCACGC
GCTCGAAGACCGACTCAAACGACTGCTGCAGTCCTCCGGTGTAGCTTTCCAGCATCTTGGCCATGTCGTCCATCGCTTCAGTTTCAAAAATGGCGCGGAA
AGTTTCGTGTTTTACAGTCGGTAGTAGACTTGGCTACATTTGACTGCGGCAACTTGCAAACCTTACTCAATGGAGTTCTCGATATTTTTCTAGTCAACCG
ACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAATGATGAGGAAGTCACCTGGCGTTCTACTACGAAATCCAGTCGTCGAGGCGCAGCTTGGTCC
TGGCAGACTTGGGCGCAGCGACCTTGATGACTTATCTGCGGCCGTAGCCACCACGGTTACCACCGCCGCGGCCACCTCCACGGCCACCACCACGACCGCC
AGTCATGTTACCGCTATTGTCGCGCGTGTACGGCGAAGGCTCGATGCCAGGTACTCCCAGGAGGTTCATCTTTTTGAGTGTCCTCTTCTCGAGCTTGGGC
ACCTCGTCCAGACCGATCATGTCGCTGTATTCGGCCGCAAGTTGCACGAGCTCCACCGACTTCAGCTTGAGACGCTTCGCGTTCGAGTTGTAGAAACCGA
GCCACGCCTGGTACGACTGCTGCGCCGACTTCTCCAAGTCACCGTGGTTCTTCAAGTTCTTCATGACGTTCAACGTGCGCGACTGGGACGGCACTAGCTT
AGCCGGCGAGTAGTTCTTGCTTGGCTCAAGAGGTAGGTCAGTCAGCTGGTTCAATAGGGTCGTTTCAAACTCGGACAGGATAAGCACACCCTTGCCCTTC
ATACCAGCACGCGCCGTACGTCCAAGGCGGTGAATGTACTGGTCACGGTCAGTGAGACCCACCTGGAGCACTAGCGACACATCCGGGTAATCTACGCCAC
GCGCCGACACGTCCGACGAGAACATCATGACCTTGTGGCCCTTACGGAAGGCCTCAGCCGTCTTCGTGCGCACCGCTTGACTCTTGCGTGAGTGAATCTC
AAGCACACCCGGGAAGCCCGCGGCTTGGAAAAGCTGGGCCATGAACTGCGCCGAGCGAGCGGTAGGGAAGAACAACATCACCTTGTACGCCGGCAACTTC
ATGTGCGCAGCCAGCACGTGCTCCATCATGGGGACCAATTCCTTCATCGAGCACACAATGTACTCCTGCTCCGTCTGCGCGTTCGTGTCAGCCTCGTTCT
CGTCGATCGTGTCTACGAACGCGTAGTCCGAGCGCAGAGCCACACGCTTGAGCTCCTCTGTCGAAGCAGGCAGTGTGGCGCTGAACAGCAGCGTCTGACG
CTGCTTCGGCAGGTAGCCAATGATGCGCATGACATCCGGGCGGAAACCCATGTCCAGCAGTCGGTCAGCTTCGTCCAGGATCAGCACACTGGCCTTGCCT
AGTCGGTCAGCGATCCTGCCAGTGTTCTGCTTCAAGTGGTCAACAAGACGTCCAGGAGTAGCGACAAGGATGTCAATAGGCGCGCTGCTCGTGAGCGTGC
GTTCGTCCTTCTTGATGTTGGCACCACCCACGAAGCAGGCCACGTTCAGCTCGTGGAACTTGGTGAGGCGCTTAGCCTCGGTCGCGATCTGCTGCGCCAG
CTCGCGCGTGGGCGAGATGGCAAGCGTTGGGATCGTGCCCTGGCGACGTCCCTCCTGCACCATGTTCTCGATCACCGGCAGCAAGAAGGCCATGGTCTTG
CCGTTGCCTGTCTTGGCCTTGGCCAACACGTCCTTGCCCTCGATGATGAGCGGGAACGTCTCGTTCTGCACGTTCGTGAGGCGCTCGTACTTGAGGTCTT
CGACGATGGCGCGCTTGGTCTGGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGGTAGTCCAAGTTCGTGGGCTTAGAGGCCTCCACCGGCGC
AGCATCAATGGGAGCAGGAGCCTCCTGCGCCACCGGGGCAGCGGTCTCTTGGGTCTGCTCGGAGTTCTTACTGCCGTTGTTGCGTCGGCCGCCGCGACGC
GGGCGCTTCTTCTTGTGCTCGGCGTCGCTGTCCTTGCGGTCGCCGGCGGGCGCCTTGCGGCGCCAGTTGCCGTTGTTGCTGTCGTTGTGGTCTTGGCCCG
GCATCTTGAGTTGACTTGGGTGCGTGCGTGGCCGCGGGAGAAAACTGAAGAGTGAGTTAAACGGCCACAAACCAACCGAAACGTGTCCTTTCGCGGGCAA
GACAAGCCACTTGGCGTTTGTATGCTCATTGAAAACTACGATATGGCATACTGCGACAGTTTCTTTCCATTGATCTCCCGATCTTCCACTTCACAATATG
CCACAACACAGTTACCTACTCATGAAAATCCAAACACAATTAATTTTAAATACTTGCAGACATGTCGACGCTGGCCGACTCGTTCCTGGAGGACCTAGAC
GAGCTCAGTGGGGGCAGCAGCGACGAGGGGGAGACGCCCACGCCTGTAAACGCAGACGAAAAGGCCGAAGACGGAAATGACGCCGACGAGCTGATGCCCG
ATGCGTCTCAATCGGCCAAGAGGAAGCGCCAAACGACCGAGGAAGAGCTGCCAGACGAGAAGACCCAGGACTTCGCTCAGGCGCTGCGCTCAAGCGTGAA
GCAGCGCGGCGTGGCGGCCGTCGCGACACTCAAGCGCTCACCCAAGTACCTGGCTCACGTGCAGGAGATTCAGCAGTTCGTGGACGTGGACGACGCAACA
GCAGCCAAGCCCCAGCAGCTCGAGGAAGGCAGCGCCGAGTACGACCTGGTGGTGACGTCCAACGACTTGATGGTGCAGATCGACGACGAGATCGAGGCCG
TGCACCGCTTCATTGCGGAGACGTACGCCGCCAAGTTCCCGGAGCTGGACTCGCTCGTACCGAACGCTCTGGACTACGCTCGCGTGGTCAAAGCTATTGG
CAACGCGATGGACCTGACGCTCGTAGAGGAGCTGCCTAAACTGCTGCCCAGCTCCGCAGTCATTGGCATTTCCGTCACTGGGTCGGGGACCAGTGGCAAA
CCGTTGGCCCCTGAGGACCTCAAGACGTGCATGGAGGCGTGTGATGAGCTGCTGTCGCTGGAGAAGGACAAGAACATGATCCTGCGCTTCGTCGAGAGCC
GCATGAAGTACTTGGCGCCGAATGTGTCGCAGCTTGTGGGCACTCGCATTGCAGCGCAGCTCATTGGACTTGCTGGTGGTGTCGCGCAGCTTGCGAGGAT
CCCGTCGTGCAACTTGCAGGTGTTGGGGCAAGAGAAGAAGGTGTTGAGTGGGTTTTCTTCCGCTGCTGCATTGAAACATACGGGCGTCCTGTTCTTCAGT
GACCTGGTGCAGAGTATGCCCCCCTACTTGCGCATGAAGGCGTGTCGAGCTGTCGCTGGAAAGCTAGCGTTGATGGCGCGCGTAGGACAGCCAGCCGCAC
CAAAATGACACGGAAGGTCTCGTGGGTGCACGCTTTCGGACTGAGCTAGTTGGTAAAATGGAGAAATGGCAGGAACCTCAGAAAGCCAAGACGAAGAAGG
CACTGCCGATCCCAGACGAAAAACCGCGACGTAAGCGCGGTGGCAAGCGCTACCGCAAGATCAAGGAGCGGCTGCAGATGACGGATGTACGCCGTGAAAT
GAATCGGCAGTCTTTCGCGACAGCTGACGAAGAGTATGGTGACAACGCCATGGGAATCACATCCGGCCGCCTTGGCCAGGAAGGATCGGGCAATTTGCGA
ATTATGCGCAAGGAACAGAAGCAGTCGAGCAAAAAGCTGCGTGCCGCGAACTTTGCTGCGTCGTCCGCTAGCAAGCCACCGCTTTCTGGATTGGCATCGA
GTCTTGCCTTCACACCCGTGCAGGGTATTGAGCTGATGAATCCTGAAGCTGCAAAGGCTCGTGTTGCGGAAGCCAACAAAAATACTTTTCAGCTGCTAGT
GGGTTTGTGAGCGTCGTCAAGAAGCCGTAGA