Description :
From Genome Similarity Track
Location :
contig_47:439748- 441284
Transcript NameFunction/comments
g7908.t1hypothetical protein PHYSODRAFT_491072
g7909.t1hypothetical protein PHYSODRAFT_286380

Sequence
1536 bases(100 bases per row)
CGGGCATCTGAAGACTTTCTGCCTCGTTAACCCGCGGTTGATTCTTCCGCAGAGCGAGCACGTCTTCCTAGTGAACGGCTCCGTGCACACAATCAGTCGG
CCTCCAGTCCTGGCCGTCTTCTTCTCCCGCATATTTCTGAACTTGTACGGCTACCAAGTCTATATCATCCGAGCCGTCTTCTGTTGATGTCGCGAGGACG
ACCATCAGGGCGATTTCGGCGTCGTACCATCTCCGACACTCGGAACTCAGATAGCTGCACCTCGCGGTAGGTGAGGGATAACAACTTGGTGACCTTCTGA
TGCAAGTCCTTCACTCTACGCTTGGTCTTCTGGTGCGTAGCGTATATGGTCTTGCTCATTCGCTGCCGCTTGCGCGACTGAAGGTCCTTCCTTGACTTCC
GACGGAGATTTCTAGGTGCGTGGACCGGTAGTTGCAGCCGTTGAAGTGTGCCCACGCCGAATGGATTGCTTCTTTAAAGTATAGGAAGACCGAATCGAGC
ACTTTCGAATTCACTTCGAAGTGGTACGCTGGAAGGTAGTCCGTGCGGGTTTGTTTGGTACAGATTGGCCGGTACCGACGTAAGATCGTTCAGCCAGAAA
CAGTCCTCACTCGATCGCGTCACGACTTCATTCCAGACCGCTCGGTATGTGCCGAGCATCTTCTTCAGGAGCTCGCGCTGTTAAGGAGTGGGGTCAAGCT
CAATTTTGATGCAGCTGTTGACGTCGTCGTCTTGGAGCATTGGGTCGTCGAAGTCGATATCGCGCATTGGGGTCCTTCTCAGGACGGACTGGTTGCTGAG
ATTCCTCAGACCGAAGAAGGACGTGCCCACCAGCGGAAGGGCAAGAACGCCCCTGGACTCACCGCTCCGTTCAGAGAAGTCCTCAGCAACGGGTAACCAC
ACCTCCTCGACGACATCTTCGTCCCACCAGGCCGGTCGGTCCACCGCTTGAGCTTCTTGTGTCAAATAGCAGAATGAGTAGTCGGTCTGCATGCATGAGA
CTCGATTGTACGCTCTCCTGAAGACACCGCTAAAATTTTCGCATCGGGTACGTGCTCAAAAAGCCACCGCCAAAACGTGAAGACGCCGCTAAAACTTCCG
ATTGCCTTCGGGTACGCGCCCATACTGACGCAAACGCTTGGCTCAGACTGATTGATTCTGGTTGAATCACTGGCCGTAATCGCTAATAGCGATTAACTGC
CCCGAGTTGCGCCAGATAGCGCTTTGATCGCGGCCATGTTGGAAGTCTTTGTTGTGTCATATCGCTAGATGCTGTCACGCATTATTCATCTCACTCTATT
CTGCGGCTGCCGACTTTCGTCGCTGCTTGAGCGGCGGCTCGTTCTCTTCGGCCTCAGCGTTCCCGCCCTCCGCCGACGCCTCCTCCACGTCCTTGGCCGT
CACTGCCACACTCTTCCTTTTCAGACTCTTCCGAGCCTCTGCCTCTGCCGCTGCCGCGCACTTGTCGATCTGAAACTCAAAAACCACAGGCGTCGTGAGC
TTCGTGCGTCGCACCGCCGGGACGCCCACGCCTCCA