Description :
From Genome Similarity Track
Location :
Scaffold_736:4397- 7905
Transcript NameFunction/comments
g16468.t1hypothetical protein

Sequence
3508 bases(100 bases per row)
CTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTCGCGCCGAAACGTC
GAAAGACGCATTCTTCGTAATTCTCGGCAATCGTTTGGGCCGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAA
CAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCT
CCCTGAATGAGGGGGCGCCCTTTCCCAGTCTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCT
TGACACGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAG
CCGCGCGAGGGAGTCTCGGTCCTCGTCCGATCGCGGTGTTGTCGGGCAGTAAAGCAGAAGGCCGCTTTCGTCCAGCTCGTAATCGCATGCGGTCTTGGCG
CAAGACTTAGCGTCGGTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATATTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCC
GTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGCCTCGACCGTCGTGCAGATCGCGTTACCGCTGATACACGAGCTACAGC
GTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGA
AGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTCGGCCACGATCGGAGCCGATCCATCGCTTTCT
CGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCCCTGTC
CATAGTGGACAGGAGATCGAAGCACAACAACAGTCCGCGATACTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTC
CATCCCGGCAGCCTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCTT
CGACCGTAGGGGGTGGCATGGTGATCGTCAGCCGGGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGC
TGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGG
AAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCA
GGAGTGCCAAGACCTCCTTGTCAACCATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTC
TTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACACGATC
TTGGCCTTCAGCATCGTGAATGCGATCTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCAGGGATGG
ACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCATAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTT
CAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGTCGACG
GACACTCGGTGTCCCAAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTT
CAACCTTCTCACACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGGTCTCGGCTCTGGTTCTGG
CTCGCCTGAATCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGCCCATACAGCGCGTTATCAATCACTCGCTGGTAGATC
TGTGGCGCATTCTTTAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTCCGTGCGCGTTCTGTCATGGAGA
CTACCCAAAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGGTACACCATCAG
TCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTC
GACGGCGTGATCATCTTCGCCGATAACAGGCTTTTGATCAGATCCGACAGCTTCTCACGGAACTGTGGAGCGACTTTTCGGACACGTTGTGCAACAGGAG
CTGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAACGCGTTCCCCTTCCCGATCAGGAGATGTTTCCGCCTCCAAATTATCTG
TCGCAGGCGATCGATTTCTTCCGGGGTGTTTGACTCAGGATCACCTACCTGGATATCCTCGATCGTGACTTCATCGGTGGTGGTCACTACTTCCGGCAAG
ATTGCCATCTGTCTCTCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCG
TTTCGGCCCGGGGCATAGACTCCTTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTCTCGCGTCCTGATCGCCGGTGCC
ACCTTCCTGATCCCTTGGAGACCCCTCAGCTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTCCGCGGTCA
CGACGCAGGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACATGGTCTGTAGTAG
ACTGGAAAGCTAGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGAC
ATGGGTGT