Description :
From Genome Similarity Track
Location :
Scaffold_401:4397- 6700
Transcript NameFunction/comments
Albla_Nc14128350conserved hypothetical protein

Sequence
2303 bases(100 bases per row)
ATCGTCTCAGAAAATGAAAACTGCGCGTACGCGTACACTCTACCGCCAAATGCAAAAATGCACAAACTTTTATTTCGATCCACGTGTACAATCCGACAAG
TGATTTGCTCGGAAAATTTGATTGGGATCGTGTCGGACAACCCGACATTTCACGTACTTTTAGCACAAAATACAGAAAAGGTGATTGCTGTAAATGGACA
TGCTCACAATGTGAAAAGTATGGCTATTGACCCTTTGGAAAAATATATATGCACTTCGAGCATGGATGGCACCGTTAAAATTTTTGACCTTGACATTGTG
CAATTAGAAGCCAGAGAAGTTGCAAGCATATCGATAAATTTCTCAAATATCAAAGACGAACGTGTGCCTTTGCGATGCTCCTGGCACCCTCAGGGCCATT
TATTAGCAGTACAAAGCAAAGAAGGAATGATCAAAGCGTATCAACGAAAAACGTGGGTACCAGTTCTCACTCTCATGGTTCCAGTAGGCAGCGCTACACC
ATCCGATATCCACATTGTTTGTTTTTCTCCAAATGGAAATTATCTTGCAGCTTGTACTGGATCAAAAGAGATACTGGTCTGGGATCTTCACCAAACGAAT
CCAACTGCCAGTGGAGAGAACTTCTTGAAAAAATGCGTACACTTTTCCAAGTTGTCGTACGAGTCTTTGGCATTACAGTGGTCATCTACAAAAAATACTC
TGATTGTTTACCACGCTGGTGGTAAGCTTGTTTTGATTGAAGGCGTAGTTCCATCATATTTGCCATCGCCACTTCTCCTGACCGATGTATCAACTACTCC
AAGTGTACAAAGCGCAAAGCCAATCTTAGAACCTGATGATCATGAATCTCGTGTGGAAGCAATAAAAGCTAGTTTCGGCTTTGGGTCGAACGTTGAAAAT
CGCTCTGAATCCAATTTGCAAGACATGTCGCTCACAAGTCCACAGTCTCAGTCCCCTTTCCAGCCAAGTGCTATAACACATGGTCCGGTTCAACTTTTAG
TATGGAATTTATTGGGTGAAATCGAAAGCTTTTCGGTACACTTGGAGAACGAAGATGTTCGAGATTTGATCAAAATCACATTTGTAGACAGGTCGGCACG
CAATGTTAAATTACCTGACAGCTATAGATTTACCATGGCTTGTTTGGATCAGGATGGTGCCTTTTTTGCTGCTCCGCATCGCGTACTCGATGAAGAGTAT
GATCAAGACGCTTCCATTAATCATCGGCTACAAGGTCAAGATGAGGCTAAAGGTTATATTTGTAGTATTGTATACTACCATCCCTTTCATTCATGGGCAA
ATAATAGCTCGTGGTATCATCGATTCTCGCATTTAGAAGAAGTCGAATGTATTGCTTGCAGCTCCGAGTTCTGTGCAGTAGCAACGTCGCTCAACTGCCT
CTGGATTTTCACAACTAGCGGGCTCGAATACGCACTGATTCGGCTGTCAGGTCGCATCGTCACAATGACAGCACGTGGAAGGATGCTAGGTATATTCTCG
CAAAGTCCCATGGATCGACTTGAATTTGAATTACTTTCAGTACGAGTATGGAGTGATAGCTGTCGCGTGCAGAGTATTGCGAAAGGAATTTATCCCTCTT
CTCCACATCCTTTTGATGTTTACGGCAATAAAGAAGAAAAAGAGCAGTTACGGCGACAGAGGACGCAATATGGGATCCTGGAATGGGTTGGTTTTGATGA
GAATGAGATTCTATATACGCTAGACTCCTATTGCTGTGTTCAGGCACTTTGTGCGTCTAGCGGGTGGCATTGGATTCCTATCGGCTGTCTTGGCAATGTG
ATGGACAAATCGCCAAAGGATCGTTTTGGTGTTTTCTCGCTAGGCGTCAATGATGACAAGTTGTATTATATCCCGATCGAAAGAGGACAAAAAGCACCCC
GCTTACGTGGTAAATTACGTCCGGTGCCGAGTACATTCGCACTTACAACGGCTATGTTCCCGCTCACAAAAGAATCTAGCACTGAGAAATCTACTCCATA
TCAAAATCTGATCTGGCAGCATGCACGAATGCACCATCGCCTCTTGAGTTCATCAGATTCGATGAGTTCATCGATTTGCGAGGAAGAGAAGCTAGCCCAA
AAGCAAGCCGAGATGGACAAAGCGCTGATACTTATGATGAAGACAGCTTGTGTCGATGAAAATGTCACCCGCTGTTACGATCTAGCCCGCTGTCTTCATC
TCGAGAAATCGCACCGAATCGCGGAAAAGGTTGTGAATCATTTTGGTCTCCACCAGTTGTTGAAGCGTTTGGAAGAATTGTACTTGATCAAATTCAAAGG
ATC