Description :
From Genome Similarity Track
Location :
Scaffold_18:43964- 45605
Sequence
1641 bases(100 bases per row)
GTTCGATGCTGCCAGCTGACCCTTGACTCGTACCTTCTGAGCCAGGGTAACCCTAGGATGACATCAAATTTGTCATCCAAATCAAGTACGATGAAATCAT
CATTGTACTGCAAATCTTCTAACGTGTAGTGAAATCCCACTACACGTTTCATCATTGCTATCGATGCGTCTGTTGCGAGGCGCACCGACAACCTCGTAGG
AGGAGTAACGCGCTCAACGGACTTGAGCCTACGATCCTCTATCGACTGGCAACGAAAAAAGTTGTTCTACGAACCACAGTCAACTAAAGCACGAAGTGAC
AAATCTTTTGTCAATTCTAAATTCAAGGTGATTAGGGATACCTCACCAAGTGCAGAGACACACAAGTATTGTGAGTCTGGAGCAACTTTCATCAATAGAT
TTGTAAATTTTGCAAATTCTATTGAGATTGCTGGATCAGTAGGGAGCTCCGCCCCTGCTGACCCCGACCGTTTTTTTACGGTCCTCTACGCTGTTGTGAC
TTCGCAACAGCGTCGGACCCGCGTCCGTTGCCCTTCTTGACAGGCGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCGTGAAGCACTACACCCGT
ATGCGTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGTTTTGAATCGCTAACTGCTTGATGAGCGAGGTCTCTCGTTCTCGACACTGCAGAGTTCCA
TTGGTTCTGTACCTCCCGCCTCTACTGTCTCGAAGGACGATAAGGGGTCAAGCTAGTGTAATCCTGTCTCACACTAAAGTCCTCTTGCACCGCAGTTGTA
ATCGATTCCTCAAGCGACTTCAACTTGATGCAGAATACGTGGTTCCTCACGGGACCATCTATAAGGCCCTGTAAGAATATCGTGATCAACACGAATTCAC
TTACAGGGTTCGCTACCATGCAACTTGAAAGGTAACGAACGTGCTTAGCGCAAGCGTTAACGTCATGCTTACCTTGTTTTATCTTCAGAAGCTCTGAAAG
AGTCCTGAACTCAGCTCTTGGCGACTTAAACGTTTGGCTGATCAGAGTCTTAAAGACCACCAGCGATCTAAACACGTTTGGATATTGTAATTAAAGATGC
AGGGCCCAAGTTCTGGCACGCCCTGAAAAATTCGATTTGGCAAATACAACTTGCATTTCCTCATCGTCGATGTGGCGAGCCTTAATGGCATCGTCCACTT
CGAGGACCATCTCAACAGGGAGTCTTCTTCAACTCCTCGGTACTTGGAGAATACTAACTTTAGATTCTCGCGTCGACGCTCACGTGTCGACGCTGGAATA
GCAGACAGAGACTATTATTGTCTCAGGGGCTCAGTCTGATGATGACCGTGCTGGTGCAGCAGGGTTACTTCAGCTCGCGACGCGTCAAGCCCTCGTTGCA
AGAACTTGGCGATTGTGGAATGCTGTTGGTTCCTATCCCTTGAGAATAGCAGAGACCAGACAGCTTCTTCGCCAACAGTCGAACTCAGTCTTTCGACCGC
ACTCCGTTCGACATCACTCAAATAGGAGTGACTTTCATGGGTGCCGTGAAAGGTGTCGTCGCCTTCGTCGTTTAACATGTTCATGATGAACGGGTTTTGT
GGTCCTTGGACGGACTACAAAGTGCTACCAGGTGTAACGGG