Description :
From Genome Similarity Track
Location :
Scaffold_82:43957- 45433
Transcript NameFunction/comments
Phyra_83060ipiB1 family glycine-rich protein

Sequence
1476 bases(100 bases per row)
ATGCTTTCGTAATAGCCAAACACAGATCAATAAAATACATTAGCCTTTTTGGGGTAGTTCAAAGGTGCAACTTGGTTCTATGGGTGGTGCTCCAACAAAC
AACACTCGTATTAGGTCAACCAACTTCAACAAAGAGCATACAAACATCAGTACAAATGTGAACTCCTTCTCGAGACCAGCAGCCGTTGCAAAGTTTCCAC
TGCAAGATTGCGGTGCACTCGGGACGTGTTTGCCAGCACCTGCGCATCCTCGAGAGCTCGAGCGTGGCGACAAGCCACGCAGTACCTTATAATGAATGCC
CTGCCTTTGCTGCCTCCAGACAGAGGCGTCCGATACATTGAGACTGGGAATGAGCAACGTGTTTCAAGCACTGCCGCCCAAGCGGTGGCCATCATCTCAC
CAGCAATATCCTCGTTGGCGAGGATAAGAAGACGTAGGGACTGGTGCACGGACAGCTGCTCGGGGTGGCAAACAACCCCCTTGATTAACTGTGACTCATA
GACCACCGTGTCGAAATGGTACTTGTTGTAACCCAGCTGACTCACAGCTCGTGACACCGCCAATCAATCGCCATACATATGGATCTCCTCATCTAGACAA
GATGCACCATGTGCGGCTACGGCTATGATGGTCACTGCCGGCAACTACCCCATCACCAGTTGACTGCCGTGAACAAACACCGCCTCACTCTCACGAGCTG
CATTTGTCTCGAGATCTGCGTAGAGCCCTTCGTCTGTCACTTTCAAATTCACTCTCTCGAGCACAGCCCAACCCACCGAAGCATCATTTCCCTTATTTTT
GCTTCACTCCACTTCAACAATGTTCACCAGCAGAAAGATTTCCGCCCTGTGCCTCGCCGTCGTGGCCCTCTCGGGCACCACCCACGCCGAGCAAGAGGCC
GCACAGACCTTTGGACTGCTCGGTGCTGGTCTCCCCGGCATCGGAGTCGGCATCCCAGGCGTCGCTAGCGTCGGTGTCGGTGGGCCTGGTGTCGTCGCCC
CGGGTGTGAGCGTCGGTGTACCTGGTGTTGTGGGCGTGGGTGGTCTACCGTACGGAACGGATGTCAGTGTGGGAGCCAACGCACTGGGTGTCGGAGTCGC
CAACACTGCTTCTCAGAAGACCTACCGCAACCTGCGCTCCGAGTGAGTGAGCAGCGTGCACTCCATGTCGGTGAGGTATGAGCCCTGGGTCACTGAACGT
TCTACGATACAGTAGCTTGCGCTTTATTGATCGAGCGTGCGCCTGCCCATTAGCCGTTCGCGTTGTTTCTTGGTGAGTCTAGACACGTTAAAGGACGAAT
ACAAAGCACGGTCCGCAAACTGCACTTGACTCGTTATCTCGTTGCCCAGATAGAGCACCAAATGTTGGTGCAGTCGTCGTCGTCGTAGGTCTTGCTTGAT
AATATGTGCTTCACGCAGAGACCCACGAGTGCATGCGGATGTAGACAGTCGTCTCTTTAATTTGGGGGGGGGGGGT