Description :
From Genome Similarity Track
Location :
Scaffold_1:4395488- 4396685
Transcript NameFunction/comments
Physo_478061predicted protein

Sequence
1197 bases(100 bases per row)
GACCAAGTGAACTCCATGTTTCATCACTTCATCCGAACGGTCCTGGTGCCAGCAGGGAAGAAGCGGCTTGTCGTGTACGCCGACAATTGTTCGGGCCAGA
ACAAGAAGAATCTCCTGATCAAATTCCTGGTGACCCAGGTCCACATGGGTGTCTTTGAGAGAATCGACTTCAAGTTCTTTGTAAAAGGATATACAAAGAA
CTCCTGCGACAGAGGGTTTGGACACATCCGCAAGTACGTGTCGCGACAGGATCTCTGGACAATGGGTCGCATTGTCGACGCGGTGAAGGACTCTGCCACG
TCCAATGCGACGGTTCACATCTCGCGAGGCGATGATTTCTTCTACAGCTACAAACCACTAGTCTCTGAGCTCTACAAGACTCTAGTCGGTGTTCAGCAGT
TTCAGATTTTCTCGATGGATGCGTCCAAGCCGGGAGTGGTGCAATGCAAAAAGGGCCCTGATAGCGATACTGAGGAACAAGATCTCCGTAGAAAGATTGA
CGGTGTGTTGACGGAAGGCACCAAGGTCGAGCGGATATTCACGCAGTTTCTGGAGGCGCTGCCACTACCACCTATCAACCCGGAAAAGGTGTACACCATG
AACCAGACCGTTCGCAAATACGTGCCGGAGGAATTCAGGTCGGACGTGATGTATGCAGCCCCGTCGAAGAAGCAAGGCGAAGACGCAAAAACGGCGAAGC
AAGCGCGCCGTGAGCACCGGGAAGCTATGGCTGCGGCTGCAAAGGAAAACCGTGACCGTCGCGGACGCGACACTACACCTGCTAAGAAGCAGAAGACATC
CGGACGCTTAGCTTTCTGCTCAGACTTAGGCAAAGCATTTTGTTACCTGTCTCCAATTGTTAATCAAAATGATACTTAGTGTCACTCAATGTCACTATTC
TGAAATTAGACACACAAGGTAACTTTTAGGTTAGTTCCACGTCGAATCTGAACAATCCGACGCCACCATTGGCTCCCCCGTGCAATTTTATGTATAGACC
ACCAATACTTTTTTTAGTTTTCGGCTTCGAAAAAGAGATAACCTTTTCAAACGATCATAACTTCATGGGATTTAAATTCTAGAAAGCCAGGGAGGGCTCA
TAAGAAAGAGGAGACGCTGATCTACGCAAAGATGCCCTTAAATCGCGATTCGTACCTAGGTTGATTTGTAACCGGGTGTTTGCCGCGGTCTCAAATG