Description :
From Genome Similarity Track
Location :
Scaffold_794:4395- 6010
Sequence
1615 bases(100 bases per row)
CCCACGTGGGCTCGTCCTGATCTGCCCACTTGATCTTGAATTCACGCACTGAGCGTCCCGTTCTTGTTGACATGGGCATCCGATCATCCAGAATCTCCAA
CACTTCGCTCTCACCGGCCAGACTATCAGGTGCCCAGCTGTCTTCGGGGAGTAATTCCTCGTCGAAGTCCAGCCGTGAGTCTTCGGTGATGTCAGGCGCC
AGTCGAGTCTTCGGGCGGTCTTTGAATTCACTCACCAGCTTCAACCGCGAGACATGGACTACCGGGTAAAACCGATAGCCGCTCCGGTTCGGCAACTCGA
GCTTGTAGGCGTACTCTTTGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGGTCAGCCCCGGCTTGACACGTTTCATGTA
CAGCCATACTCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTGATTGGTTGGCGTTGCTGTCGACGACTTG
TTCCTGCCAGTCATCGGGATGGTTGATCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGTGCTCGGCGGGCTTTTTCAGTCGCTTGGTATTCCTTGG
CCATCTCGAGCGCAATCTGGTGTTGTCGGTTGACGTCCCGGCGCCACGCCAGCGCGTCGGATTGTCTGCTACTGCCCCTACGGAGCGATGACGACATCGC
TTTCAACGTCGACTGAGCGTCCCATCCATGGACGAGGAAGAATGGAGTTTCCTTCCGTGTCATGTCTTGTGAGTTGTTGATCGCGAAGACCAACCGTTCC
ACGATCTCGTCCTAGTCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGGTTGAATCACCGTCTTCACCGACCTCTCTTGCTGCCTGTTGGCTTGGG
GCCGATAACTCAGCGTAGCCCGCGACCTTGACTGCATCATTTCGGCAAAGTCCTGGAACACCTCGCTCATAAAGCGAGGATCCCGGTCGTGTCTAACCAA
CGAAGGTGCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGACATTGCCTTGGCGATCACAAATCCCGTG
AAAGCACATTGGAACAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACGAAGTCCATGGACATAATTTGGAGTGGTCGCTCTGCCA
ACACGTTGCCGGGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTACTGCAGTCCGGGCACGACTTCACATGCTTCTCGACGTCTGTGTAGAGGCC
GAACCAATAGTAATCCCGCTTGACTCGCTGGTAGGTCCGCACAACCCCTTGGTGCCCGCCTTCTAGCGAGTCATGGCAGTTCTGCAACACTTCTTGAATC
ATCGGGGTGGGTACCACGAGACGCAGCTTGATCTCCTCTTGCTCTCCAGACGTGTCTCGACGACTCGAATTCACATTGTCGAGTAGTCCGTCGTCGGACA
GAACGAACTTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCTCGCCTCGGAGGACTGTTTTCAGGTTTGCCCACCGTAG
TTCCTCGTCCTGAGC