Description :
From Genome Similarity Track
Location :
Scaffold_692:4395- 5565
Transcript NameFunction/comments
g16830.t1hypothetical protein

Sequence
1170 bases(100 bases per row)
AGTAACACTGGACGCACCTAGAGTCGATGCGCATCCAAGGGATCAGCGGCCCAGGAATCTTTTCCTTCTTTCTGTAGGCGATCGCGTGTCTACAAGAAAG
CATCATCGTCATTCCAAACTCGCAGTTGCACTCCCACGTGTCCACGCGAAGGCGATGCGTCTTCCTGGGTCCTTGCACCACGACTTGACCTTCTTCACCT
TCGGAGACTGCGAACTTGTACCGTCCAGCGCTGGCAAGCGCTCTAGTTTACTGGTTTGCGATCTGTTCGGCCACGAAGTGCGACGTGAAGCGAAGGACGT
TTGACATCTCCTCGTCGAAGTTGCTGTTCACGAACTGTCCAATCCTCGCCACCCGATAACTATACTCATTCTCCATGCGGCGATCATACGCAACAAGGGC
CTTCACGCACCCAGCCATGCTCGAGGACCCGTCGACAGCATCCTTCAGCTTCCCAAAGAAATTCTCCAACCTGTTGTTGGTATGGTTCCTGAAGTGCGGA
AGTTTGGCTCGATGGTACAGCACCCAGCGTTCCTGCGACGCATCCCAATTCTTCTCAAAGTAAGCGAAGAAATCCTGCAAACCAACGCGATCACAAATGC
CGTGGAAGGAGTCATGCGAAATCTTGTATTTGTCTGCGCTGTCTGAGTAGACCATAGCGTGGACAGCCGCGTCTACCTGACTTGCGTCATCTGCCGATAT
CTTGCAAAATTCTGGCTTGGCCCGCTTTTCCTTGAGGTATTTGATCACGTGAAAGTGACAAATTAACACGCGCGCCCTGGGAAAGTTCGATTCCAGCACC
TTGATTTCGTTGAGGTCCTTGTCAACGACAATGACACGAAGCCGGTCAATACGTGTTGGATGGAGGCGCTTGAAATGGGCCACTGCGCGCTCCATGTGCC
AGTCTCCATTGGCCTCCAACAGAGACTGCTGGACCACTGCGCCCTCCCCAAATTCGTTCATTGTCATGATGGTGAGCAACTGGTAATTGTATCTGTTACA
AAGCATAATAAATCATGGGTCAATACATGAGTAATCATGGAAAAATCATGGACACAAAATCACACTCACCGATTTGTCTTGTGGCTGCAATCCACCAACA
ACAACTCGCTGAAGCGACTGTAGATGCGCCTCATATGCGCAGACGCTAGCGAAATCACACCCGTTTCTCC