Description :
From Genome Similarity Track
Location :
Scaffold_28:43944- 46265
Transcript NameFunction/comments
Phyke_g1768cysteine protease family C01A, putative

Sequence
2321 bases(100 bases per row)
CGATAGCCGtctcgctctcttcatcaccttgGTAGTCGATGGAGACCGAGAAGTCGGCAGGCTTGGAGCCATCCGGAATCGGAACACCCCAGTCACAGTC
CTGCTCGATGCCCAAGTTGTTGTGGTGCATCGCAATTCGGAACCAGCCATTCTCGCCCCAGTACGTCCCCCACGAGTTGCGACCGATCCCTAACAGTAGA
ATTGCAAGTGGGTCAGTTATATGTGTCCAGTATGCATGAGCGACTCTCAATAAGTACTTACAGTATTCCGTGTCCGTCTCTTCATCGTAGCCCCAGCCGG
CAACGGAGATCTCATGGTTAATCAACGGGAACATGACGTGTTCCGAGTAGATGCCCCCCACGTATGCCTCAAACTTCTCCGTGGCATGCACACCGCAACC
GATGGGTCCACGCTTGTAGATCTCGGCCTTCATACGGTCTGCACCGCTGACCGAACCGTACTCAGTGACATAGTACTTGGCGAACTTCTTGATGGGCTCG
CAAACTCCAGGCGTGAAGGAAGACTTCGAGGGCCAGCACCTGCGTTATAAACAACGAGGGCACCAGTCAGTCGCTATCGCATCAACATAAAAACAAACCA
AGATCACTCACGTTTCACAGACAGCGAATTGGTCGCATTTCAGGTTCGTTGCCTGGTAGGCTTGACATGTTTGATCAGGGATACCATGACGATGCGCGTA
TTCGTAAACCAAACCAGGGTTGCCACCGTTGCAAGTGCCGCCGGCATGGCAGTTAATGAGCACCTGAGGTGACAGCGCAATTTCGGGCCatgatgctgca
gacacagCGCAAGGTTTGTTAGTAAAAAAAGTGACAAAACAAAACCCTCACAAGTTTCTCAAGCATGAATGGAAAACACCCTCTTACCATTTCTCATAAT
GGAGATGCGATCTGATAGCGCGCTTGTCGTGCCTTGAGCCCAGCAGCTACCGCAGTACTTAGGAATGTGCTGGTTCTTGTCCCACGTAACGTAGTTCTTG
CCGTTAACGTTGCGCCAATCCCAGGTCTTTGGTAAGTCCTTGAGATCCATCGTCTCGTGCGGCAGCGGCGATATCACGcgttctccaccagcaaactGTA
GTTTCTGGCGACATCCGCCAAGCACTGAATCCACCGGCTCAACGTCGTTCACTTCATCACcgtcctgctcttcttgctcttcttcaatcGTGATTGGGGT
AGGCCAACCGTCATCCTTGGGCACGCCGAAGGAGCACTCACCCTCAACACCGACGTTGTTCACGCCACGCACCAGTCGCATCCAGCCATCTTCACCCCAG
AAGCTTCCCCAACTGTTACGCAGCACCCAGAAGGGTACTCCATTTTCTTCTCCCCACCCTACAATGGAGATCGCGTGGTCCACTTCCGTCGAATTGGTCT
TGTCATCAAAGATACCACCCGAGTACTTCAAGAAGTCATCGGTGACTGCAACACTGCAGGCGATTGGTCCTCGTGCATAGATCTCCGccatcatctgctg
ctctccCAGCGTCGTGCCGTACTCCGACACAAAGTACGAATCGTACGTCTTCTGCGGGAAGCAGCCCTTGGTCGGCAGGCAGTTCTCACACACATCCATA
GCTGTGCATGTGTTGCCCGTGTCATGTCCTGTAGCTGCATACCGTTGGCATCCTTCTTCAGGAACGCCCTTGTCCTTAATGAAGCGGTATGCTTCCAGTT
GGTCCCCTCCATGACATCCGCTGTCTTTCTTGTCACAGTTCAACAGCACTTGTGGGGACAGTACCACTTCTCTGTGGACTTCTTCAGGCGACTTGTTACC
AGGACTCCGGTCCTTGGCGATCAAAATCCGATCCGCTAGcgctgaagttgcagctggtAAACAAAACGGTACAGTTTACGGTTGATCAAACGGATCAGTT
TACGGTAAACTAATTTTAGTGTACATCCTTGGTGGGAACATTTTGAAGTGATAAGTGCAAGGAATTGGACGTACCGAATGCCCAGCAGGAGCCGCAGTAG
TGAGGGATGTGCTGGTTGCGACTGATTGTGACGTAGCGTGTGTCGTTGACGTTACGCCAGTCGAAGTTCTTAGGGAGTTTGGCCACGTCTAGGTAGTCAT
GAGGGCGAGGCGACGTCAGCGATTGGGAGCGGTCAGGGTTGCGCACgtagccaccgccaccagGGAGAGCGTCGTATGGAGaggcagttgcagttgcaac
cGCCAAGGCGAGGATCAGTGACACTCGCATGGTAAAGTTTGCGCCTTGACTCTGCTTGGACTCTTGCGAAATGGCTTCAACTAGAGGGGGGGCGATCTTC
TTAACCTTTGAAAGATGATTG