Description :
From Genome Similarity Track
Location :
Scaffold_75:43944- 45633
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.6Metalloprotease family M48X

Sequence
1689 bases(100 bases per row)
CTCGGCGCGCATCTGGTGCTCCAGCGCCGCCTGCGCCTTCTGCACGAGCAGCGCCAGCAGCGACCGGTTCAGCGTCTTCTTCTGTGTCGGCGACATGCGC
TTGTCGACCGCGTCCTGCAGCGCGCGCGGCAGCTCCCGTGAGATGAACTTGAGGATCTCGACGCGGTACATGGCGGCCGTCTCCTGGTTGAGCAGCACGC
CGCTGGCCGCGTCCGCTGCCGGGCTGGCGGCCGCCGACCGGTCCTCGTGCACCCACGCGAGCTTCTGCTGGATGTCCGAGTGGACGGCGTCGGCCACGCC
CTCAACCTCCTTGGACCCGGTGACGCCGGCGTTGGCGGCCTGCTGCACGCGCAGGAAGCCGATGATGCGCGCCACGATGCACGCGAGCAGGTCGTTGCGG
GTCTGCGCGGCCATGTGGCTCAGCTGGCGCACGGCCACGTCGGGGGACGTCCCCGTGGCCGGCACTGGTCGAGCGGCGGCGGCGAACCGCTGGCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGTACGCTTCCCATTCCTGGTGGTGGGGCTGCGAGCCGCCGTCGGGCGTCGACACGACCGCG
GGGGGCACGGTGCTCGCCGCGTGGCTCAGGAACGCGAGCCGAGGACTCATGAGCGCCATGGGCGACGGCCGCGGACTCGGCAGCNNNNNNNNNNNNNNNN
NNNNGTCCCTGGTCCTCCACCTGCTCCGTTGTGGATCAGCGACTGCAGCGGCCGTAGATGGTACGTCCCCACGGGGCTGCGCACCGTCTTGAGGTCGTGG
CGAGGCGACGGGAACAGCGCCTCCTGCGTCGACGGCAGGTGCGTCGNNNNNNNNNNNNNNNNNNNGATAGCGGCTGCGGCGCGTACGGCGCGGTCGGGAC
GGCCGAGCTCGCGGCCGACGGCGTCACCGGCAGCGGTGCTGGTGCTGCATTGTAGCCCATCCCTGCGGGCGGCGCTCGCACGGCGCGGTCGGCCTCGGAG
CGCGCCGTCAGCGCTTGCATGACGGTCAGCATGTGCTTGTTGAGCTGCTGCACCTGGTCGCGCAGCCCGTGCATCTCGGCGCGCAGCTCGTCCATCTCGG
ACCGGTCCACCGGCACCGTCGTCGTCGTCGCCGTTGGCGTCGCCGTAGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGTTGGTGCG
TCGCTTGATGTCGCGCAGCCGGTCGCGCTGGCCGCGCACGAACTTGTCGTGCCGGAACTCCCACCACCCGGTCGTGTCCTCCGCCGCCTTGACGTCCGCA
TCCACCGCCTCATGGCCGTCAGTGGGCGTGGCCGCTGCAGCCGCTGTGGCCTCGTTGCCGCGCACCTTGCGGAAGCCGTAGAAGTTGAGCTGCCGCACGA
ACGAGCTGAACTTGTTGTGCTTGAAGTAGGCGGGGATGACGCGCTCGGCGAACGCGTCCGGCCGCTTGACGACGAAGCTCTCGCCGTGCGGCGACCAGCC
CGCGAGCTCCGGCGGGGCCTGCTCGAGCATCTCGTACGTCTTCTCCAGGAACGACGGCGCGCTTTCGCGCTCGTCCGCGCGCCGGCGCTTGACGCCGCGA
GACGCAGCTCCTCCCCCGCTCGACTCCTTGCCGCCGGTGGTCGGCGACGACTCGCTCCCGTTCGCCGACTCGTCCGCGCCGTCGTCCGC