Description :
From Genome Similarity Track
Location :
Scaffold_34:439418- 440529
Transcript NameFunction/comments
Physo_134898putative polyprotein

Sequence
1111 bases(100 bases per row)
GTTAAAGTAATTGATGGGCAGTTAGTCTTCATCCCTCTCTATGTTGATGATTTGATTCTGTTTGCCCCTTCGATGGAGCTCATCAACAAGATGAAGAAGA
TGTTCGAGGACCGATTTGCGATGAAGGATCTCGGGGAGTTACACTACCTACTAGGCTGGGAGATCACGCGGAACCGGGCCGAGAGGACGATGTTCATTGG
ACAGCAGAAGTATGCCGAGACCGTGCTCAAGCGGTTCAACATGCAGGACTGCCATGGCTGCAAGACGCCGAGCACGGCGGATCTGAAGCTGAGCAAAGCC
ACGTGTCCGACCGAAAACGATGAGAGGCAACTGATGACATCGAAGCCTTATCGTGCTGTGGTTGGCAGCCTGATGTACCTGATGCTCGGTACCCGGCCCG
ATCTGGCCTACCTGGTTAGAGAGTGCAGTCAGTTCTTGGAAAACCCAGGTCTGTTGCATTGGAGAGCTGCAAAACGTGGATTGCGCTACCTGAAAGAGAC
AGCGGACTGGGGGATCCAGCTTGGTGGGCTGGCGTGGTCAGATCAAAAGCTGGATGATCACCTGAGAGCATACGCCGATGCGGATTTTGCAAATCGAGTT
GATGATCGAAAGTCGGTTGCAGGCTACGTGACTCAATTATGTGGGAGCATCATTTCGTGGAGCAGCCAGACGGAGAAGACCGTCGCGCTGCACACGACCG
AGGCCGAATATATGGCTCTTAGTCTACTGGTGCAGGAGGTGGTGCACTTGCGCCAAATGCTGAAGGAGCTATAGGTGCAGCAAAAGCAGCCATCCCAAGT
CTTTGTGGACAATGAAAGTGGGAAGAAAGTTGCCAGCAACCCTGTGTTTCACTCCCGGACCAAGCACATCGATGTGCGCCACCACTTCGTGCGTGAGCGC
ATCGATTGGAAGGAAATCGACGTGCATCGGGTGCCAGGGGTTGACAACGTGGCCGATGCTTTTACAAAGCCATTAGCACGTCCGGCATTTGAAAAACACA
GAGCAGCAATGGGATTATTGTCGAGGGCAAGATTTGGAGATGAAAATTGATGGGAATCCGTAGGTGGGGCTGTTGCGGATTATACTGATCCCCACTATAC
TACTTGCAGTT