Description :
From Genome Similarity Track
Location :
Scaffold_1164:4393- 5485
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1164-fgenesh-gene-0.1Dual specificity protein phosphatase 9

Sequence
1092 bases(100 bases per row)
ACCTCAAAATGGACGTCAACGATGATGCCGCTGCCTATGACGGCTACGGCGGCGCAGACGAGGAGGAGTACGAGGTGGAGGATGTGACGGACGACACGCC
GATGCACATCACCGGCCGGCTCTTCCTCGGATCCATTGACGCGGCGCGCAACGACGAAGCGCTGAGCAGAGCACGCATCGCGTTCACGCTGGCGCTGCTC
GGCGCGACAGACCACGGCGACAGGATCCCAGCAGCGCCGTCCAGTGGCACAAACACCCACAGCAGCGAACAGAGACTCGTGTCAGCAGCTACATTGACTG
ATGACGTCACGCGCACAGAGATCGCGATTGAGGACGCACTGGACGAAGCGCTCTTTCCCAGACTGCCCGCGATCCTCGCCACGCTCAACGGCATCCTGTG
CGTCCATTATTCACACTGGTGGCCAGCTCGCCTGGTGGTTGAGATTATGTCGTTGGTATGTGTTGTAGACTGACATGACTGTCTTCTGTAGCGAACAAGC
CGAGCGTGCGGATAAGAACGTGCTCGTGCACTGGTAAGCTCACCACCATCCATACTACTGTTCGCCTGCCACCTGTCACCAACCAATGTATCTCTGTTGC
TTCTGGGTGTTTGTTGCCCAATGTGCCAGTGTTGCGGGTCGCTCACGCTCGCCGTCCGTGGTCACCGCGTGGCTCATCGCCCAATCTCCCGCCAGCAAGT
ACACGAGCGCCGCGCAAGCCATCGAGGAGATCACGTACGATTGGTTGGTTATACAAAGCCAAACTATGCCGCATACCGGACTGAACTATACACTCTCTTG
CCAGCTTGATTCGGCCGTGGATCGCCATCAACGCGCACTTCCAGAGCGAGCTGGAGCTCTTTCTCAAGGCCGCAACTTGCACGGAGCTCCAGCAGCGAGA
GGTCCAGGCACTCGTGCATCGGAACGACAGCCTGCCTCGCGTGGACTTTGGCGAATCGCTCGTCACCGATATCGTCGCAGGTAGAAAGACCATCACCATG
CGGCTCGAGAGCGACCGTGAGGACGACGCCAGCTCGGACCTCAAGGACGTTTTCCAGCACTCGACCGTGGTCGCTACAACAGCAAGTGTCCA