Description :
From Genome Similarity Track
Location :
Scaffold_534:4393- 5411
Transcript NameFunction/comments
g12892.t1XP_008893225.1 hypothetical protein PPTG_01608 [Phytophthora parasitica INRA-310

Sequence
1018 bases(100 bases per row)
TAATAACAACGTATGATATGCCTTGGTTTGTACACAAATGTATTTATCTAAGGCTCAATACTTTGTTATTGATTAAATAGTTTGGTTCCTAGCGAGTAAG
TTTTCCCATGTTCGTCAGCGGAGCGCAACGGAGACTCCCACTTTCAAGTTGATCTCTCGGTTATAGGTGCGACCAAGCAATCAAGTCCAGTGAGCCATTG
AAGGCATGTGTTAAAATTGGCGACCCTTGTTATTTTACTATTCTCGCGGCTGGGTCACCCGGTGCGGTGAAAGTGATGCACGAGTTTGTTGCCGTGCCGA
TATCGACAGTCACCATAGCTCGGGACGAACTTTATGGGCGTACTAAACAGATACGACCCAGTGCATGCTGTTATATCAGTGATCTCTACTCCTGATGGAC
TGGCGTGTCGGAGCTTCCGTATAATATAAAAGTCAGAAGGCTCTGGATCACGAACTATTTTGTGAACCCCAACTCGACAGCATTGTAGGCATATTTGTGT
GTACCGTGCCTTCATCTTTGCTGGCTAACTTGCCTTCGTTATTCACATTGTCGTGGTCCTCGCTGAGCGAGTCTGGAGCGATGGCAATTACCATGTCCTT
GTATTACGAACTGATTGAGAGCGTCATGCCAAATTCTTTTCGTTTTTTGTGTACCAGTAAGTTAGAATGTTTTCACATTATGTTAGGATGCAAGAACGCC
GGGTCAAGTGCAACGTCTTAAACCAAGAATCAGTATGCGACGAGTAAAGACGTTGCCTTCGTCTGCAGAAGAGCAACAGCGAAATTGCTGTTCCACGAGT
CCGAATAAGGGAGTAAGACTTGAGCACGGGAAACATGAGACAGGGTAACCAAGGTCACCGCTGCAACTCCAGTCGACGAGAAATGGTGTGCATTAAGCTT
CGTTATGCTTTAATTTTTCCAGCATTTCTATCAACCCAATAGTCGAAGTACGCGGCCCACTTCAGGTAAACCTCATCGGTCTTCTTTTCTGCGACGGAAA
GCTTGGACAAATTCATCT