Description :
From Genome Similarity Track
Location :
Scaffold_69:43929- 45737
Transcript NameFunction/comments
Albla_Nc14054990cellulose synthase 3 putative

Sequence
1808 bases(100 bases per row)
GAATACCATCTTTTTTGATGCCGTTCAATGTGGTCGCGATGGATTTGACTCGGCAGCGTTTGCTGGTACCAATGCAGTTTTCCGTCGACAAGCGTTTGAT
TCTATTGGTGGAATTCAATATGGAACACAAACAGAAGACGCGTATACAGGAAATGTGATGCATAAAGCTGGATGGGACTCGGTATATTTTCGAAAGGATT
TTGAAGGCGATGTGAAAGATCGAATTCGACTTTGTGAAGGTGCTGTTCCAGAGACTGTAGCGGCATCCATGGGGCAAAAGAAACGATGGGCGAAAGGCGC
TATACAAATTTTACTGATGAGAAATGTCTCTGAAGTCGACCCAGATTGGCGTCCACCACGTGTTCCTGCGCCAGATCCCAAACCGAATTTGGAATTCCCA
CGTCAAATGTTCTTTTACGACTCGGTTTTGTACCCATTTGGATCGATTCCAGCGCTTTGTTATGTGGTCATTGCCATCTTTTACTTGTGCACTGGAGACG
CGCCCATTTACGCCAAAGGGAACAAATTGTTGTACTCTTTTCTACCGGTGATGCTTGCGCGTTGGATGCTGAATCTATTGGCGAATCGAGCTGTGGATAA
CAATGATGTCTGGCGAGCCCAACAAACGTGGTTTTCGTATTCATTCATTACACTATTAGCAATTTCGGAAGCCATTCAAGCTCGAATCACAGGGAAAGAC
AAGTCATGGGCGAATACGGGTGCAGGACAAAAGACTTCATGGACAGAAATTCCCAATGTGCTCATGTTTTTTACGATCGCGGTTAGCGAAATTGTGGCCC
TGGTGAGATTCTTTCAGTATGAAAGTGCTACGAGTCCGTGGAATTATGTGTCGGCAATGTTTTTTGGGTTTTGGGTGATGGGGAATTTGTATCCGATGGT
GAAAATGAGCATTACAGAGTACTGTGGATGGGATCATACGTCCGCGACGTTCACTGCGAATGTGTTTGGATCCCTTTTACTGGTTTTTGTGGTCGTATTC
GTGCAATTGTGGCAATTTTACTATCAGAGCAATTTGGCGGTCGCGGAAGGCGCCAATTGATAATACCTGTGGGAATTCGTTACCTCTCGATTTTGATTTT
AGGCTGCTGTATAGGGTAGGGTATTTGGTTTTGAATGTAGGGTTGTATTGGCTAATTGAATAGGATTGTGTTCGAAAGAATTCGAGAATTCGAGTTTGGT
GTTTGAGTGGTGGACCGGTTTTTCTTTCAAAGAAAGATTTGGACGGACGTGAGTTGATGGTACTCGTTGGTATCGAATGAGAGTTTGATTGGTACTGAGG
GAGGATTTGAATTGTGTGTAGGCTGACGAGTGGAAAACGAAAGGGAACGCGGCTCTAAGTGCGGGTAACCCTAAAGAAGCGATAGAGTATTATACCAAAG
CGATTGAAATCAATCCATCGGATCACGTGTTTTATTCAAACCGGTCGGCGGCGTATTTATCCCTCAATGACTCTGAAAACGCGTTGAGGGATGCTGAAGA
ATGTATTACTCGTAAATCGAATTGGGCAAAAGGATACGCTCGTAAAGGTGCAGCGCTTCATGCGCAGAGGAAGTACAACGAGGCGGTCGCAGCGTTCGAG
AAAGGACTCGAGTTTGAGCCTACCAATAGCGCGTGTATCACTGGGAAAGATGAGGTTGTGAAAGCAGAAGCGGCAGCAGCTACGAATCCTTTTGCAAGTG
CTTTTGGACCCGATATGTTTGCGAAAATCGCAACGAATCCTAGGATCTCGTCCTATTTGAGTGATCCTAGTTTTTTACAGAAAATGCAAGAGATCCAAAA
CGATCCTT