Description :
From Genome Similarity Track
Location :
Scaffold_254:4392- 8142
Transcript NameFunction/comments
Phyta_totarag6230hypothetical protein PHYSODRAFT_543861

Sequence
3750 bases(100 bases per row)
GATGGACTCGGAGGGCTTTACGTCGCGCGCGTGGCTGGGCCACTGGGTCTCGGGCGAGGAGGAGCCCGTGAACAACTACTACGAGGACCACAAGCTCATG
GAGGGCGCGCTCATCAAGCTAGGTGACTACGCGCACTTCCGCTACTTCCTGCTGTTCCGCAACGGCCGCTTTTGCTACTACGAGCTGCCGATGCCCGCGG
CGGCGCCTGGGGGAGGTCCCGAGGGGCCGAGGCGCGTGCACCTCACGCTCACGTCCAAGCACCTGCGTGGCGTCATGATGCTCAACGCGTCCGTGAACGC
CAAGGACCTGGCcaagagcgaggacgagtacgacgcCGACCTCATCAAGCGCGGCCTCGTGTTCaaccgcaagaagctggagatgcagctcaCAGGCTAC
TCGCCCACAGGGCAGCTCATGTGCTGGAAGCTCAGGGCAGGCAAAGACGCCGTATACCTCAAGTGGGAGCGTGCGTTTCGACTGGCGCTCCGTCCCATCT
GGGTGCAGAActccaagtgctgcatgGTCTGCAAGAAGgagttcagcttcttcatccgcCCGCACCACTGCCGGTACGTTGCGACGGACTGTTTAGTGGC
CGGCTGCGTTAGTAGACAAGTTAGTTACAAGATGGGTACTGACGTGTTATCTGTTGTTGCTCTCGACCACTACAGCAAGTGTGGCACGTGCATGTGCGAC
GAGTGCTCGGTGTTCGTCCCTCGACTGCCTATGCAGGGCTACTATGATGAAGTGCGCATTTGTCGAGACTGTTCGCCCGTTAAGATCCAGCGATCGTCGC
TAAAACTTGGCACGCGCGTGTTGGTGTACGGTATTTTGGTTGGCAGAGTGGTGCAggttgatgctgcagatgATTCGGAAGACGGAAGGGCGTTCGTCAA
TGTGgagctcgtcaagaagaacaaccAGCTGCGGCGGTTTGCGCTGGAGCACGTGGAACTCTACTCCGACGCAGTTCTGTCAGCCAACCGCATCAAGAAT
GCGATCCGCCAGCACCTATCGTACACTGTCTTTCGGACACAGCTCAACTTTAACACATGGAATTTGCTGGAGACCGTTGAAGAACAGCGCACAGTGCAGA
TGGTACGAATACTCAACAAGTCGACGAGTATCAACGAGCTACACTCAATGTTGCCGATGCTCGGCTCGTTAGATACGATGCAGTTCCCCGACGATGACGT
CTCTGAAAAAGATCGTGTGAAGGAGTCCCTTTCGCATTACCGTGGTGTACATGTGTCGTTTCCGTTGCGGATGGACACGGTGAAGAAGCTTATTAATCAG
TTCCGCAATGGCATTTTGCTGCACCGCGTTTTCGTACGCCAGATTTTGGACGAATCGGATAAACTGTTTCGAAAAATGCACGAGTCGCCTATGAATGAGA
TCGAGATACCAATGGGTGTGCAGTTGGTAGTAGTCGGCGACCTTCATGGGCAGTTGGAAGATTTGCTGACGATTATGGACAAGAACGGCGTGCCTAGCAG
CAAAACGTGGTATCTCTTCAATGGTGACTTCGTGGATCGCGGATCACACGGAATCGAGGTCATCCTGCTCCTGCTAATATTCAAGCTATTGTACCCCGAT
TTCGTCTTCTTGAACCGTGGCAACCACGAAGAACGAATGATCAACGAGGTCTTCGGGTTTGAAGATGAAGTGTATACGAAGTATGGCACGGACAACGATG
AGGTGGCTGGGTGGAGCGGTCTGGGCACATCTCTCAATTACTCGCCgatgaagctcttccagaTGTTCGAGACAGTCTTTGGTTTGTTCCCGATCTTCGC
GTTGCTCAACAAGCGTGTTTTCATTGTGCATGGTGGCTTGAGCAATCACGAAAACGTCACGATTGAGGAattgctccagctcgaccacAGGCGCGAAATT
CCGACTCAAGGCACAAGCCGTGCAGATGAGGTTTTTACGCATTTATTGTGGAGTGATCCACGTGACGAAGACGGGTGGAAACCGTCAagccgaggagctg
gtgtgGAGTTTGGTCCTGACATCACGAAGGCCTTTTGCGCGCAGAATGAAATAAACCTCATTATTCGGTCGCACGAatgtcgagaagaaggtttCGACAT
TGTTCACGACGGCCTACTCCTCACTGTTTTTTCGGCATCAAGCTACTGCGGTTCCCAGACCAATAAGGGTGCCTACGTTCAGCTGGAGTTGGGACAAGAC
AACGAAGTTAAGCCACACGTGGTGCAATTCTCTTCCCAGCCGCTCCAAAAACTGAAGGACGCCGGAAGAAATGAGTGGCGAAAAAAAGCGCAGCGATTGG
AGCGAAGAACTCTGATATCCCTCGTTGAGATAATTTGTGAAAAGAAGAATGCGCTGCTATCTGCTTTCAACGAGCTGGACACTATTGGTTATGGACACGT
GACGAAATTGGAGTGGAAGGCAACTTTACAGAAGGTCTTGGGTATTCAAGCGAACTTCCTCTCATATTTCCATCAACTGGCGGAGGAAGATCAGCAAGGT
AGTGTCAACTACCAGAAATTTCTCAATCGCTATACTGTTGAGCTGGATGGTGGAAATGTAGAGTGGAGGCGCAACCTGATCCGCAAGGTTTGGATGGGGT
TCTGCCAAGCGCTTCCGCATCCATCCGAAACGGACGCTGAAAAGATGACGCTCCAGGATAAACTTCACTTTGCGTTCAATCTTTTCCAGTTGTCCCCTCC
TGGAGCCGCCAAAAGGGAACTTGCAGTCTCGAAACCCGACAAAACCGGTCCAGCTAGTAGTACCTCCTCCAATGATGATAAGCCAAAGGAAAACTACCTA
CGCAATGGTCTAGTCACGTACAAGGTGTTCCGGAACACTATACAAGGCAAGTTACAGCTAGGCGATACACTTTCAGAGCAGCAGATCTTTGAGTTCATGC
AGCACCTCGACCAGAATCACGATGGCGTGGTCGACTACCAGGAGTTTTGCTCGTTCTTTGCCGAGTTCAGTCGCACGGATTATTTGCAAGAAATcttcga
ggtggacgacaccaaggcCATTTCTCTCCTGAATCGTTGCGCCACACTTCTGCAGAAACCGAAAAAGTTTACATCGCTGCGGGATGCATTCGACGCATTT
GACCACAGCAAAACGGGTAAATTGACTGTGGACGATATTTTGAAGGGAACACAGGAGCTGAACATGGTGCCGGAGCttgacaacgacgaagcgcagctgc
tgttcaaCTCGATTTTGCTCAGCTACTACGGCATCAACCAGCGACATCAGTGGGATACGCGGGGCTTGAATTGGATTGTGTTCGAGGATACGTTCTCGCC
TGACAGCACCTTCCAGCGGCGCCTGTGGTTGGCAAGCCTGAGTGCCTCAAACACAAACCTGGCCGCGCTAGACGTTCGCGACTCGTTGTCCGGGGACAAC
GACAGCGTCCAGGACGGGCAGCCTTCGAAGAACCAGGCGTGGGCGGACACGTTCGTTGACAGCGTCAAGCAGTCGCTGCATGAGCAACGTCTGTACATCA
AGTTCCTGTTCCGGATACTGGACCGCAAGAGACACGGATATGTCACCAAAGAGCAGTTCGTCGCTACCATGCAAGCCATCAACGAGGAGCACGGGGCGCC
ATTGAAGCTCCCCCAGCTCGAGCAACTGGCCGAAGCTTTCGCGCACCGCAAGACCGTCCGGCGCATGTCGAATGCAGGCGAagagacggaggagacgcgC
ACGTACGTCTCTTATCCTGAATTTCTTCGCAGCCTGCGCATCATCGACTC