Description :
From Genome Similarity Track
Location :
contig_58:43908- 48963
Transcript NameFunction/comments
g10396.t1hypothetical protein

Sequence
5055 bases(100 bases per row)
GAGAGCACGTCGTGACGAAACTCAATCAGACCACTCTCCAGAAAGCTGACTACCGGATAGGTGGTTAAAAGCCTCAGCTGGCAGAGCTACAAGAAACGAA
CTGAGGCCTTACTAAAATGAAGATCGCGAGGCAACATGACACGGGGCCGTCTCCCGACAGGGTGACGCCAGGGATGGCAGCGAAGCCTGGCCAACGAACG
ACACGAACGGGGTGTGCGGCAGCGGCAGGATTATCGCGCGGACACTCGGGTGAGGGGAGCGACAGCTAGCCGGATGCAGACCAACTGGAGCAATATGGCC
CGGCAGTGGATCACAAAACCCAAACACGGGCTGGGGCGAGAACAATTGAAGAAAGGGATCCAGCGCGAGGCGCCGTGGTGTGAGCGATTGCATGTATAAT
GCTCGGCGACGGAAGAGAGGCACACAGCGGATTACGTGAAGGGGGCGCGCATGCACCAAGGAATTCGAAACCGGCTTCACGCCTGGTGGCTTACGATGAC
CGTAACGACAGACTGGGGCGGAATGGTGGAACACCCGAGGATGCGAGAGAAAATCAACATGTAAGAGCTGACACTGGTCCCCGCGCATGCATGTTGGGAC
GTTCATGGACGGAGTTCGAGAATACGGTACTGATGGAGTACATGGCGGGAGAGCTGGAACTGCTGCACCCTCTAAACGTTGTGAAGGCAATCTTAGTGGC
GGAACATAGGGCTCTACTAGAGGACTATCATGAACGGTATCTCAACGCAGTGCAGACTGCAAATCTACCGCCGACGGTACGGGTGCTCCTCATGCGGACC
TCTTTAAGGAACGTTTTCAGTACGGACGCACGCTTTGGAATCAAGATGATGCGAGTTTTCCAAGCGGCAGTGAAACGCATCGAATATGATGGAGTACACA
CGCTGAAGGTTGTATTCTACTCTAGGAGCGCGGCGAATCGATGGGTGCAGAAAACGTTACGCTTCCACCAGGCTATTGTCCCGCTGTTCGACACGTCACG
TAGACCTGGCACGAAAAACGCGGGGATATTTACGCTGGAGAACTGGAACTGCAGTACGCAGTCAGGGTATCTGGAGCGGCGTCGATGGGGTTGGCAGCGA
TTTTGCTTACTTTTTAACGCTTCGCTGGTGCCGGAATCTTGGATGTGGAATACGCACGGGCTACCAAGACGGACATGTACGATAACAGCTAGTACACTGT
GCGGTTCGTGCAACTGGAGTGTCCTACGGAGATATGGGATGTAAGGAGGGTTGGCTTGGGAGCCAAATGGTTAGTATACACCATTTCAGACACAGCTGAG
GCGCCCCTGCGGTCGCTTCTATAATCGCCAACATGATAAGAGCAAATGCAGGACCATGGATGCCAACATAGAGCAGATACGGCTGCGCTACTCTCGACTG
TACACGGGCGAGAGATTGCTGCGGTGCGACCGACCACCCGGGCTGACTACATCGCTGATAACGTTGGAAAGTTGGTCGAAGCACTGCGTACTTTGCAGAC
GGACGAACAACAACACCAGCAGTTGCGCGCCTCGACGTTACAAAGGTATCTGGACTCTGCCGTAGATCCGACGCTAACTGGACGGACTGCACCACCTTCA
CTCCTAACGGAGGTGGACGCACCGTCGGACTCATCGACACGAGCCCAGCAAAGGCAGTAGAATGGGGAGAGTCAGAAGTCTTCGACGGATGCTGCAGGGT
ACACTGTGCACCACTCACGGGGAGCACAACAAGCGGGTAAGAAAGCCAAAAGCGTCCACAAAAACGGTAAGACAGATTTTGAAGTAGGCAAGGCTGTAGG
CTCGCTTAAACAGTCATTGGGGGCATCAAAGTCAACAATTCCGGACGGAACCAATAAAAGGGTGGCGCTTTCGGTGTCTGGCCTCAAGAAATCAAAGAGC
GCCAAATACGCGACGAAAGCTAAACAGATACAAAGTAAGCGGTTCGGAGCCTTAACAGGAAGAGGCATGGAATACTGCGATTCCTTGGCTGACTCGGAGG
GATCGGTCCTGAACGATGACTTAGGCACTGTGACTGCTACTAACCTCATTATGGACGTGGACCACGTCGGCCACATTTGTGTCGACGAGAGGAATCTGAA
TTATGGGCATTCATTACCAGACGTCGATGGCCAAATGGTAGCGACAAGTGATGAATACAAGGATCTCGTCGAGCACGACCTACTGGAGCTTCGGCTTCCC
CAAAAGCGTGAAGACGGTAGCAGATTTGACACGGCCGACCACAGTGGCAGCATCATCTATGACGAACAAGCAACCAGGGGCAGTGTTCTTGACAAAGCAA
CGAAGATGCGCAGGGGGGACGATGTGCCAAGTCTAAGACGACCACAAAGGAACGACAGCGCAAACAGCACAATCCCAACCGATCTGGGAGCAGTGGACCT
GTCTGAGGATAATCTCAGTTTGGTACAAGCCAGCATGTCCAAGTACATGCAGGCGGGCACACCAAGCGAGGAACGTGGCGGAGTCGGCGAAATTGTGCCA
GCCACGCCTGACTCTCAGGTGGACGTTACCACGATGATCCGTGATCTGCTGAATTTCTCACCTTGTGTAACCGTTGGTGGGCTGGATCTGCTCTCTCGAC
GCTCCGAAGAAATCTAGCTGTGTGTTTCTGGACCGTCCTGGCGGGACGCGTGGATGGGGTGGAGCAGCGCGGAAGTCTTCGCTCTGCTGCCGGTTATGAA
TCCAGATCTGGAGCGATTCAATCTAGCTCTGATCTGGCGGCCTGGGCTTGATCCGAGGCCGGGGGTCGCCTTTGGGGTTATGGATATCTTCTTCCTTTGC
GTTACTTGCCGCTTCCTATAGCGGGACTAGGGGGGGGGGGGTAGAAATCGAGAGATCTTCTGGCCAAGTAATAACTCCATCGGATCTGGGATCTGCACTT
GATAATAGATCACTAGTGTATGTAAAAGCTGGCCAGTATAAGTATCTAGACTTACACAACAACTAGATCAGCTACTCCTTGCCAACACCTTGTAGGGCCA
ATGTAGTTTCCGTTTCTTGGTGGAGGCGAAGCACTCGTAAAATTCAGGCAAATTCAATTCTGATTTATGGTTAAGTCCTATCACATCCTTGGTCCTATCC
TGCATCCACTCATCTACGGCGTACGACCGATTTTGCGTCTTTTCTATTTTCTCACTATCCTTTCCGTCGTCGTTTGCACCGGATACCTTGATGTAATGAC
CTGATTACGATATCTCACCATCCCATGCTCCACTATCAGGCCAGATCCGAGATCCAAGATCCGGGTTCTGCTTCACCACCACCCCAGATCGTGACCCGGG
TGAGATCCGAGATTCAAGATCTGGGATATGCGTCTACCTCACTGGCGGGCTAGATCGTGATCTGGGCAAAGCTTTCCGTGGACCAGATCCCGATCTGGTC
AGCTTCGGTCCCCAAGACTTCCCCCATCTCGGCGATGCTTGATCTGGGTGCGTCGTCACCTTCTCAATCTGCACATCGCCATCTTTGACCTGGTACCGCT
TTCTTTAACGATGGTTCCATGAACCGCGACGTACCTCGAGTACACTTAGATCTTGATCTTGGTACAGCTGCGCGCCCGGGTTATCAGCCGGATCTGGCAC
CCATGGCGGGGCCCATCACTTGCCTCGTCCTTTCTGGTCCTTTTCTCGGCAGCATCGCCATCTTAGTCCGAATTCGTCCAGCTGCCATTGTCTCGGGACT
GTGACCTCTGCATTTCATTTTCGATCGCATTTTCTGGAGGGAACTTCACCACATATCTGTATAAGGAGCATCGGTTGGAGAATGGGGACGACCATGAAAG
TGGATATTCAGAGGCGCCCACGGACAGGAATGCCGCGGTCTATCTGCGCACATGTTTTGACCTGCATGTGCTGTCCATCTTCCTCACTCTGCGCAGACAT
GAAATTCACTTCTACGGAGTAGGGCATGGAGACCTGTACGCATGCTGACAGGCGGAGGGAAACCAAGCCAATGCAAATGTGCTACCAGACGCATATGACT
GGAAGACAACGACCAATATGTGCAGCACTGAGCACGACTCATTGGACTTAGTCACTCTTAACTTGTTGGTGGACACTGCTAAGGCAAATGCCTTCATCGC
CAAGAAGGTGTCACAGCGGGACAGACTAGATATTGTTCACAACCGCAGAGGCATCCCTATGCTGGGTCGTCAAAACTTGCTGTACGACCTTGATGCACTA
CTCTGTGCAGAGGAGAGCATGATACATGCGATATACGGGGCTGATGGGTACGCGGTGTCCCTTGCCAGCGAAAGGGAGAACAAAGGAAAATATAGCGCAC
TACCGAAGCGACACACGCGGGAAGCCGCTGGACTGGCAGTGGAAAAAGCATATGCTCGGATCCTGGGAACAAAAGAGGAACATTATCTACGAATAGAGGA
TCGACCGCTGATGAAATTAATGCGAACAGCCAACTAAGCAGCCGGGTATCGTACTGGTCGCCTTCACGGGAGAAGAAGGGAGTCATGGGTATACTGCTGG
ACTCTTACGGGGTCTATACCAGCATGACATCGTACGCGCAGGATAAGTGGTCACCCCACTTTATGGCGGTGAGCGGTGAATTGGAAAGTGAACAACTGAT
TGTGGTCAACATATACATACACACACCACTTGAGAGCGGGCAGGAAGCGCTTCTTCCGCAAACCGCACACAGTCGAATTTGCTGAGGGTGCACGGGTGAT
CGTAGGGGGCGACTTCAACTGCGCTCTTGACGATCAGGCAGATCGTAGCTACTTACGGAAGACGTTATCACATGGATCACCAGCATTGCAGGAGTTGCTA
GCGATCTAGGGCCTGACAGACACGGTCGCACTGCGCCGCCCAAAATGCTGGACCCCACAGATGCTGACCAAGCATCGTCAAGAAACTCACACCTACACTT
ACACCGTTCCAGCGTGTGGGAAAGCCACGTCCCGCTTGGACCGATGGTACGTCTCAGCCACGGCCTTCGACTGGGCAGCAGAGAGTGACGTGGTAGAGCC
GGAGGAAGAAATCGATCACACAGGTGTGAACCTCCATCTCGTCTCACCAGAGACC