Description :
From Genome Similarity Track
Location :
scaffold_116:43905- 50417
Transcript NameFunction/comments
Pl_109416hypothetical protein PHYSODRAFT_468125
Pl_109417conserved hypothetical protein

Sequence
6512 bases(100 bases per row)
CTTCCAGAGCTGTTTAATGCCAAACATGAAGCGCACGAGATCCGAATGGACTTGATCGATATGCAGTCGCAACACAATACGGCATTGACCTACTGCGAAC
AGCAATTCGTCGTCGAGAAAAATGTCCGGTAGGATTTTTTCATTATTGTCATAAATGTTTTGTTCACAAAGTTGATGATGCGCAGACAATTACGCAAAGG
GATTGGAGCGACTCAACAGCAGATCCGACAAAAGACGGAGGACCTCGATGAGCTTCAGTGTCGAGTGCTGAGATTGTCCAAAACGCTACATGACTCATCA
GATGAGAAAACTTTTGCCAAGACAAAGCTGGTAAATCAAGAAGAGATCAGGAAACAACAGTTGAATGTGAAGGGATGTTGCCATTGTGGACGACAGTATT
TACCTAAGATGCTGGCAATGCATAAAGAAAATTGTACGGGAACATCACTTCCAAAGCTGCATCCAATTGCTGGAGCAAACCAAATTGCAGACGGTTTGGA
GCTTCAAAGTGAACATTTGCAATCGCTTTCAAAAGCTTCTGGAGCACCAGAAGTGCTATTGGCTTCACGGTTTATATCTCAGCCGCCACGTAATCTACGT
GTGGACTTAAAGAGTATCACTCATAATGCGTTGACGATTCAGTGGGACCCTCCGATTTTTACCGGGTCAAACGCCATTTTTGATTATGAATTGAATTACT
CACTTTGCCACTCGAAGGTAAGACATGACGAGGTACAAAGGCAGTTTGATTCTCAACCGCCTATGCGGTTATCACAGTGGTGTCTATTGAATCCAGTTCC
TGGAAATCAATATCAATTAACTAACCTAGCGGCAGACCAAGAGTACGGTGACTTCTCAATTTGTGCTGTTACTGTCGCTGGCAAGAGCAATCCCAGCAAC
CGAGTGGATATTATTCGAACAGAGGCCGCTGTACCTCCAACGATTCCTTTGTTTTTATGCGTCGGGGTTGTTACGGCAACAAGTATTACTCTCACTTGGA
TGGAGCCTCTGGATGACGGTGGAGTGCCAATACAGGAGTATGAAGCAATTTTTACTGAAGCCGTCATCAAGACAGATAACGTGGATGATAGAGGAAATGC
TCGACTCAATGTGTCGGAAATCGACTACAAACCCCGACGAATAAGGACGAACTCGACACGAACGACGCTAACCATAACGAATTTGCTTAGCGGAGTAGAA
CATCTCAACTTTCAGATTCGAGCTGTGAATTCCGAAGGTATACAGGGCGACTACTGTGAAATTATAAAGTCTATCTTCACCATAGGTAAAAAATTCATTG
TATTGGAATCTAACTTCTCTCATACTGACTTGTTGTTTTGTGTGTTTATCAGCTCCAGGGAACGAATTCAAGCTTCTTGATGAGCTGCAGGCTGCTGTCA
ATTCTCGTTCACGTACGGTGGATTCCCAGTTTTTGAGTGGCTTTATGCAGCGCTATGAGAGGCATCATTATATTGAACAGGTATCTCGGTTTATCCTCTC
AATGCATCCGGAGTTGGAATCCAAGGTAAATGATATTATAAACCGAGCAGACCTCAGTAAGAAGGGTGATGAGGGGCTAAACGATGAAGAGCAGCAACCT
CAGCCTATTCAGCAAGCAAGTGGCCGAAAGAGATTTGACGATCTCACGGATGAGGAGAAAGTGTCTGAGCGTCGACGACAATTTCACTTTCGCATAGCTG
AGATCAGAAACGATCTGAAGAAAGCAGAGTACAACGTCCAGTGGTGCAAGAATCGCCAAATTGATTTAGTAGCGCTTATTCGTACTGCCGAGGCTCGAAT
TCTTGAGAAGCAAGCTGAACTGGAACGTGCAAGGATGTTCAAGGGACCACAAATGGATTCAGACGTTTTCGAGAATGGTCTTCAAAGGTTTTTCACGAAA
GAACTTATTGTTGCGCTGGAAGACGAAATCGAGATCGATCAACTATACATTCTGGATACAAAGGCTGAGATTGTAAACGTCGAGAATTACCTACGTGCTG
ACATTAAGCGGCGGGACACGCTAGTAAAAAAGTTAAAGGAGAGGCAAGAAGCTTTGGAATTGTTTGAAAGCAACCCAGACAATGTGACTGAGTCTACTGG
CACTGCAGCGACCCTGGCAAAACTGCGTGGTGGGCTACTTTATCGAGTATTTGCAGCTTTCGCTGCTAATCGACAGGAGGCCCACGAATCACGAAGTAAG
ATGCGCAAGGCAATCAACCGCCTCGTTAATCATCGGCTGAAAAGTGCACTTCAGAGATGGAGGGAGGTTGCAAAAAGCCTAACGCGTGCAAATGCTGGTG
TTGATGAGATATACGGAATTGGCAGTATCGGTCTGCTGAATGCGGCATTGGGACGTGACGATCTCGTGATGGAGACTCAGAAATTGCTCCACCAACTCCG
GACCACTGGAAACTCGCTTCAAGACATTCGTTGGACAACTGAGCAGCAACAAGCATCGAAAACTGAACAGCCAGCATCTGACGGTAACTTTGGCCAAACC
CGAGAACTAAACACGAAATACTTTCCACTTATATTGGAAGGAGATGCGAAGATGAATTTACAAGACTATGAAGGAGCTGGTCGACTTTACCAAGTTGTGT
TGAACAACGAACACTGGTTGCAGCTTATGAATGACGCGGAAAAAGTAAAACTACAATTCAAGATCGGTGAAACTATGTTCCACCTTGAGAACTATGAACA
AGCACTGACAACCTTCAGCCGCACAGCAATTGCGGCGAACCGAGCTGGGTTACGATATGAAGAAGGATCCGCGGTGCTTCGCATCGCAGATACTCAACAC
GTGTTACGACCTCTACGAATGAGTATTGAAAGTTACGAACGTGCCTTGCTGTTGTTTGAGGCTGTAAGGGATGTACAAGGCGAATTATCATGCTATCGTG
GTTTGCAACACGTATACGAGAAACTCGACGACCGAGAGATGATAGAAATCAACAAGCACCACGCGGACGACATTGAATTTGCTTTGACAAAAAAGCTTTC
ATCGGCCGGTAAAAAGATAATCAAGCTGCAGCAAAGATTGGTGGGTTCAGGTGCTGAATCCTCATGCCAAATTACTCTTGAGCGAGTAGGCCCCATTGTC
CCCAGACTACGAAGGGAGCGGATTCAGCGCAAGTTTGATATTCGTGAGGAGGAAAAACTAGTGGCAAGCTTGGAGAAATTGTTGTCTGAGAAAAGAGAAT
TGTTGGCTAAGGGAGAAGATGATCTAAAGCGAGCACTAGCCAGCGACTCTACTCAAGTTGATTCGACAATCATCTGTGGCTCCGATGCGCGCTATGACCT
TGAGGATTTCAAAAAATCGCTTGCAAAACTAATGGGAAGTGTTAAGGTTGGTGAAGAGCAGATCGGTAAAGAGATCACAAACGCAAAAATCCGTATTAGC
AACGCCGAGGATGAAATCAAAGGCCTTGAAGAGGAACTAGTTGTGGAAACGGGGCCACTGATGCGCAAAATCTTGTCAAAAGAGCGAATGCGTTGTTTCC
GATTTAATGCAACTAATGAAGCTCTGAAAAATGTGGTGGGGACAACTAGTCACGGAATTTCAACTTGCTTCGCATCTGCAGGGGTGAACGGCTTCGTTTT
TGATTTCTTGTCAGGAGCATGTCTGGCCCAGGTTGTTGGTGATATACGCAAGAACCACCTTGGTGAGCCTACAGGCCATCAAGCACAAATACTCTGTGTT
TACTACATTGGTCATCGTATTTACACTGGGTCAGCTGATGCTTCGCTAGGTGTTTGGAACGTGAATATTGAGGTGATCGGTGGCTTCTCGTGCTCACTGA
TACGAATGCTCACAGACTTTGATGCTGCAGTTGTCAGTGTGGTCGCTGATACCCAATGGGTTGTTTGTGGGTGCACAGACTGCGATGTCTTCATATTCGA
TACTGAGTCATTGGCAACAATCGCCCACATTATCTCAGCCCACGATCGCACCGTGACAACTTTGTCCATTCAAAGTGCCAACTCAGCACTCACAACAGGA
GCTGCTGATAACAAGATTAAGGTATGGGAGATTGGCAAAGTCTCACAGCATACCACACGTCGTAACGTAAGGTTGGTTTGGTGCCTCGAAGCTGAACGTC
GTGGTGACAACTACTTCAATGGACATCTCGCACCCGTCACGTGCGTGAGGCGCGTTGCAAATGAAATTGTAAGTGGGGACAGCGTAGGTCGGATCGTGAT
TTGGAATCTCGATGCAGATAGCAAACTGCTTCGGATCTGTGATGTACATCAAGATGTAGCGGTGACTTGTCTTCAGTTTGATGCTACACGTATTGTCAGC
GGTGCGAGCAATGGACATATTTGTGTGACTGATTTCGCGACTGGAAACCTTATTCAGACGCTATATGGTCACCATGAAAGTGTGCTAGACCTGCAATTTG
ACCGAACGCGGTTAATAAGCATGTCAGCTGATGGTAAATTGCATTTGTGGTACTGGCAAACTCGAGATGGCATAGGAGGAGACCGAAAGAAGTATCATAT
CCTTGGAGCAGGTGAAACACTGCGTTCACTATCTTTACTGTACCGCACAAGTATCCAGAAACTCCTTCAATGGAACTCCATTCCAGACTCGGCAAAGACT
TATCTAGGCCAAAAGCTCATTGTGGAAATCGATGCTAGTGCAAATGCATCTGATGAATTAAAGACACTTGATCTCTCGAGTTCGGTACAATTTGGCAAAC
TATCCTATGAAAACCTCGACTTTGTGGCGTCCAATAAGACTAAAAGTAAAGACGTTGAATCACAATGGGCTGCACAGCGCCTTGCAATGCTTGCAAAAGA
GTATTTCCCCTCTTTGGATGATGAAGACAGCAATATCAATGCGAAAGAAGGTGAAACAATTGCAGAGGAAGAGATGTCAGACTCTGATTCCGAAATGGAC
TCCACTGCAGGCGAAGATGAAGAGGAGGCAGGTGAGTAATACGACGATTGAAGACACCAAGCGAAAACAATGTAGAGAAGTACCGAGTACATTGTTTCTG
ACGACCAAAGACGAACTGCGGTTCAAAATGTAGACGTGGAACCTGAATGCAACGTAGAACCGGTGGAAGCAGCAAAACTTCACTCACACAACGTTTTCAC
CAGTTTCCACGCCCCATGCAGCCTTGTCTTCGAGATACATATTGCAGCTACGGAATGCTGCCCGTGCATTGTCGCCCGCGAAGAATTCCCAGGCAGAATA
GAACCAGAATGCGACGCATTTGCGGTAGTCGTTCGGCTGGCTCGACTTTTTCATCTGGAGGATACTTCGCCATTCCTCAATCACGAAAGTCGAAAGTGTG
TCCTCAAATCTCGAGAGACGCAGCGGGTTGCGCACTGTGTACAAGGTCGTCCAGTATTTGTTGTAGCCTTCCAGCTGCTTTAGTCCGTCCAGAAACTCGG
GTGCTCGGAACTCCCCAATCGAGTAGTCAAGCATAAATGCGAACTTGTCACTGTACTTGGCCTCCTCCTCGTAAAATTTTTTCCACGTCTGCAAAGAATA
CAATAATGAGCATCGAAATCTATCACAAAAGCCTAGAACAGTACATACCACTGAGAAAAACTGAAGGGCCTCATTGGGGTCATTCATCTTAGTACGGTGC
ATGCTGTGTGCATGACGCAATTTGACCGATTTTTTACGCTCCCAGTGCCATTCTTCCACTGGAGGGAATACGGACATGGGCACCATAACGGATCCGTTTC
CACAGATCGCCACATAGAACGAAATGACGTCCTCGATTCCAACCGGTTTCTCCTGTTTCTCAGTCGTTTTGGCTCCATCTTCTTCCTCAGCATTCTCGTT
CGGATCGGGTTTGACGAAATCTAACTTGGTGACAAAGTACATGTACTTGGTAGGAAATGGCTTATGACCAAAGAATTCACGCAATTGTTCACGCAACGTC
GTCATGTCCTTCAGATATAAATTCTTGACTTCTTCCGTCGTGTAAAATCCATCTACCATAACAACATTAATACTTAATCCTACTACATGAAACTGATAGA
CCTTTTGACGTACTGTTGTCAGGACACTCCAATGCATGCGTTGCTGACGGATCTACCGTTGCGGGGTAGTTGAAGCCATCTACAACATACAAATAAGAAT
GTGTCACCCTCACGTACAACAGTGGCATTTGCTACTATAGGTCTTGAAATAGACCCATGTCAATTGACGTACCCACGCCTTCACGCAGCACGTCCTTGTG
TGTCACCCGCAGTGCATGCTTGAGGTCATCGTAGTTGGTGTTGTTGCTGCAGAACTTATTATAGCCCACCCAGTACTGCGCGTACGTCTCATTGAACACC
AAGTGACCACGTTGAATGGTACTGGCGCACACGAGGCGCGACGGATCTGTGGCCCGCAATCGATCCACGTTCTTCTTCCAGTCTCGGATCTGACCTGTCT
TGACGCCATATTTCTGTGCTGTAACAGAGATAAGCCCCGTGCGGTCTGCCTCCTCGATGATCTCGAGCTTCTTGCCTACGGTCAAAGCTCGGTCCGCCTT
ACCACGCGCCAT