Description :
From Genome Similarity Track
Location :
contig_22:439016- 459944
Transcript NameFunction/comments
g5659.t1hypothetical protein
g5660.t1hypothetical protein
g5661.t1hypothetical protein
g5662.t1hypothetical protein
g5663.t1hypothetical protein
g5664.t1hypothetical protein
g5665.t1XP_009532147.1 hypothetical protein PHYSODRAFT_516298 [Phytophthora sojae
g5666.t1XP_024573246.1 Uncharacterized conserved protein [Plasmopara halstedii
g5667.t1hypothetical protein

Sequence
20928 bases(100 bases per row)
AGGTAGACGAAAGCACTTGGCCGCCACGCCGAACGCACTACACGTACCAATGGTACTCAGTACTAATGACATCCTCGAAGATCAGCTGTACGAGGGTATC
CGGTGATACCAGCGTCAGAAGCTGTGTTTTCGAGTTCGACGCCATCTTGAAAACCTATTGAAGCTATTGGTACAATGCTGGACGTCAATAGACACCAAAC
AGTTTCCCAAGCACTGCACCGGACCAGACCTCTCTGAAGCATTCCGGGATTGGCCATCGATATGTGCCGAATTGCGCATTTTGCTTCAGATGCCATATTG
TGAGAGTGTTACGATCCACCGCAGGGGACAGCTCAACGGCAGCAATTCGCTGCATGTGCCAGGTCGATTGCAAGCGCTGCCGTCTCCTCATTCTACAATT
TCCTCCGCTTCACGCAGACGACTAGACACCCCAGCCTCCAGGTACTCACCATGAACGCGCAGACCATCCTCGCCGTTGCCGCCATCGTCCTCGTCGGCTC
GGCCGCCGCCTCCAGCTCCTCCAGCTCCGACGCCTGCTCCACGACGCAGCAGACCTCCGCCTACACGACACTGGCCAGCCTGCTCACCCTCGACTCGTTC
CAGGGTTGCGTCGACGACTCCGGCTACAGTCTCCTGTACTCCACCTCGTTGCCCACGGACGCCGAGTACGCGCTCATGTGCGCGTCGAGCGACTGCCAGT
CGCTCATCGAGTCCATCATCTCGCTGAACCCGCCTGACTGCACCCTGGACGTGCCAACCAGCGGTCTCGAGGTGAACGTGTACGAGCTGGCGAACGGCTT
CTCGAGCATTTGTTCGTCGCTGTCGAGTGACTCGTCGACCAGCACAAGCTCCACCACGACCACCACCGCGACGTCCACGGCTGCCAGCACGAGCACGGAC
ACGACTTCGACCACGACGACTGCCACCACGACCACCTCGTCGGCTGCGACGTCGACGGCTGCTTCGACGGCCAGTGACGCCACCACTTCGTCCAACTCGA
CGGAAACCGCAGCGACGGCGTCGAGCTCGGACTCCACGGCTACGACTACCACGGCTACGGCCTGCTAAACAAGAGGCGCTTGCTTAGCCTGGCGTCTTCT
GGCATGAGCTTCTCTTTTGCGGTATGCAACGGACTCCGTAGCACGTAGTCTGGACGCGCAGGTAGTTTGTACGGAGTGAACGCTAACATTGTCGTCTCCG
GCAGTGTCCAAAATATATCAAGCAGTGCCGTGTATGTGATGCGCGTTCCTTCTACCTGAACAGCGCATAGATTCACAGATAAAGAATGCGCACAGGACTG
AGTAGGCCAACCCCTCCGCCCAGTGGGGTGAGCGGATGTCCCGATGTGTATCGTGATAAGGACACCTGCGACTGTGACGAATTGCCTTGAGAACGACGGT
AGAACCTTTTGGTCGAGTTGCCTGTGGCTGGTATCCAGGACACGAACTTGCAACAAGAACCAGGAGGTATGGTATCCAAATGAGTTTATTATGATGGGGT
GGGCGATCGACCAAGAGTCGACACCTCGTCCAAAAGACGATATATACGAGGCTAGGCTGGCAAGAAGCGGCGCTCGCTCCCTCACCCACGAGAGACTAAG
CGACAGCTTCCATTCGCAACAACTTAGCAAGCGATGGCAGTCTGCGTCGTCGACGTCGTCGAGTTCGAGGTGGTGGCAGCCGGCGTGACAGCAGGGGTCT
CCGTCGTGGCAGCAGGTGCCTCCGTCGTCGTGGTCGTCGGCGCCGTCGTGGCAGCAGGGGCGGCCGTCGTCGCGGCAGGCGCCTCCGTGGCCGTGGCAGC
GCTAGAGGCCGTCGACGTCGTCGTCGTCGAGGACGAAGAGCACTTGCTCGAGAAACCGCTCACCAGGTCGTACACGTTGAGCACCAGTCCGCTCGTGGGC
ACCGTCAGGTCGCAGTCAGGCGGGTTCAGCGCGGCCACCGACTCAATGAGCGACTGGCAGTTGTCCGACGCGCACATCTCCACGTACTGGGCGTCGTCCG
GCAGCGACGTCGAGTACAGCAGGCTGAAGCCAGAGTCGTCCGAGCAGCCCTGGAACGAGCTCAGCGTCAGCACGCTGGCCAGCGTCGAGTACGCGGTCGT
CTGCTCGGTCGACGAGCACGTTTCGGCGGCGACAGAGCCAACGAAGGCGGCGGCGGCAACGGCGAGGACGGTCTTGGTGTTCATGGTACCTGGTTGGCGG
GTGTGTTTGGGGAGGAGGCTAGTTGGCTGTGTGTCTGAAACAGAGCAAGTTGTAGAATGAGACGTTGCATGTCCGGTGTGGCGGCCGCTTGGTGTCCGAA
CTGCAGCCGGGTCTGACGCTCACTCGGGCGGCAAACTTGCACGACCCAGACCCCCCACCTGATACTGGCACGGACGTCCGATCTCTTTGAACCAGTCTGT
GGCTGGGTTTGGCTGGCTGAAGCGGACGCGAGGCGTATCTTTGGAGGACGACTGGTGTTGCACATCTGTCAGAAGGTGGGACTCATGAGCGTTGCACACG
CTCGAGCGGATACACTGCCCAATCTACTGGATTTGCCATACCCAAACAACTCTAGTTTGGGTGTCGATGTGCAGAGCATGGGCGGATCACTTCAACCAGG
CGTAGTTTGGGTTCCTTCACAGTGTCCTCAATGAAACTGCGGATCTGAGATCAGATATCCATAGGGTTGCCACCACTGCTGACGCAGACTTTTGGAGAAA
ATCTGCCACAGCAAAAGTCTGTTGCTGTGGCCGATGGGCAGCCTTGTTAATGTAATCCGCTACCTGTAGGTGTACAGGCAGCGGATTTCGGCTGCAAGGT
TTTTACAATGTTCAGCGGCGAAGCTTTTGGATTGCAGCGCTTCTTATGTAAATTACGCTGCCCTCATTACACAGCCTATCAGACCAGGTCTAGCGTCGTC
AGATTCGAGAATGGCCCAAGCGAAACTGCGCTTGGGACACGCGCTGACCTGGATCCCCGTGTCACGGTGAGTCCTAATGTAGCGCTTCAAGCCGCTTTGA
TTGGCGTCGTGCTCTACACTGGCGGGCGAGACCAGCAAACTTTCTTTCATATCTCTGGCGTTCTTCCACAATCCTGGATCGAAAGTAGCAGGCAAGGCAA
AGGTCTTGCACAATAGTGTGCGCAGATACCAATGCATCCCGGCATAGTTAGATATTAAAAAAGACAGGTCGCAATGGATGAATGAAGTCGTGCTCGCGGC
GTTAACTAAGTGTACAGTGTCCCAACAAACTTTGGGAAGCTAGTTGCTGCCAGCAACACGCCAGGCAGCTTCAGCTGCCTGTCCGACGCATCGCCGCAGA
CTGCCCTACCACAATCCGGACAGATCCTTCCTGTTCGAAGCCTTTGACCTCAGTTCGGACACCGAGCTTGACGCCGCCACACCGGACATGCAACGTCTCA
TTCTACAACTTGCTCTGTTTCAGACACACAGCCAACTAGCCTCCTCCCCAAACACACCCGCCAACCAGGTACCATGAACACCAAGACCGTCCTCGCCGTT
GCCGCCGCCGCCTTCGTTGGCTCTGTCGCCGCCGAAACGTGCTCGTCGACCGAGCAGACGACCGCGTACTCGACGCTGGCCAGCGTGCTGACGCTGAGCT
CGTTCCAGGGCTGCTCGGACGACTCTGGCTTCAGCCTGCTGTACTCGACGTCGCTGCCGGACGACGCCCAGTACGTGGAGATGTGCGCGTCGGACAACTG
CCAGTCGCTCATTGAGTCGGTGGCCGCGCTGAACCCGCCTGACTGCGACCTGACGGTGCCCACGAGCGGACTGGTGCTCAACGTGTACGACCTGGTGAGC
GGTTTCTCGGCAAGTGCTCTTCGTCCTCGACGACGACGACGTCGACGGCCTCTAGCGCTGCCACAGCCACGGAGGCGCCTGCCGCGACGACGGCCGCCCC
TGCTGCCACGACGGCGCCGACGACCACGACGACCACGACGACGGAGGCACCTGCTGCCACGACGGAGACCCCTGCTGTCACGCCGGCTGCCACCACCTCG
AACTCGACGACGTCGACGACGCAGACTGCCATCGCTTGCTAATCATCATCATCTTTGCATTCTGTGCTGAGTGGTGAATGCAGAGGTAGATATGATAAAT
AAGAAACGTCTCATTATTGTTTTTTGTTGCTCGGCTTGATGTCGTGTGTTTCAAAGACAAATAGCACACGAAAAACCAAGCGTGGTAGCATGAATCCTGT
GTACAGTGGCGGCTTCGTGTTGCATAGGAACTTCCTATACGTACTATTAGGAAGTACAGTACTAATAGTGTCTTCATTGCATCTGTGCAAGACTACACGT
ATCTACAGCTGCTGCACGATGTAGCTATTGCATGTGCATCGCGCTCTCAGCGATGCAAACCTTGGCAGCAAATGAGGTGAAGCCTTCACTGTTTTGGTGA
CGAAGTACTCGCTGCAGGATGCAGGGCGTTTGCAGTGGATTCTCTCACATCTGCATGATGTAGCATGGGCGTGCCGACGCCGCCGTCCGCTATTGGTATC
AGCAGTCTACGGTGACACTCCGCTGACGTTGAGGCTCGTTACTCACCTGCAGACGCGTGCGGGATCTGCTTTGGGACACGTGAAGCGGATACACCTGCCC
GGCTCTGCCTGCAACTCCAGGATTCACTTTTCACCGCACGGGCCTGTAACTTGGAGGCTGCAACACGCGGGATCACTCGGAGCTGCAAAGCCGGAACGCG
TAAGCCTGCAAATTACCAGCAATTGGTGCTTTCAACCGCTTATGTCGACCACAACCAGAGGTTTTTACCTCCTCTTTCGGTTCTGCCGCCATGACGAGGT
TGATCTCCTTTCCCTTTCCTTGTCCACCGTGGCGGCGGCAGTATCGCGCTGTCCGAAAGTTCCACTCGGCCGCTGTTCGAACAGCAGCAGCCTTGAGCCG
CAGGCCTCGCCTCAACCAGCTCATTCTGCAATTTGCCTTCCGCATCTCACTCCATCCTCTCCACCCCACCACAAGATGAACACGTACTTCGCTGTCGCTG
CCGCCGCCCTGGCCTTTGTGGCCTCCGTGAACGGTGAGGCCTGCTCGGCCTCCCAGCAGGCCAGCGCCTACACGTCCATGGTGAGTCTGCTGCAGGGCAC
GGCCCTCAACACGTGTGCCTCGGACTCGGGCTACAACATGCTGTACGCCACGGCGCTGCCGACGGCCGAGCAGACCGCCGCCATGTGCAAGGTGGACGCG
TGCCACGAGCTCATCAAGAACGTCCAGGCTACCAACCCGCCTGACTGCGACCTGAGCATCCCCACGAGCGGCGCCGTCATGAACGTCAAGAGCCTGGCCG
ACAACTTCGAGCCTGGCTGCACGTCCTCGGCCGCCACCGAGGCCCCCGCCGCCACCGAGGCCCCCGCCGCCACCGAGGCCCCCGCCGCCACCACCGCTGC
GCCTTCCATCGAGACGACAGCCCCGGCCGCCACCACCGCTGCGCCGACTTCGGAGACGACTGCTCCGACCGCCACCACCGCTGCGCCTTCATCGGAGACG
ACTGCCCCCGTTGTCACCCCGGCTGCCACCACCACCGCCCCCACCGCGTGTTAAGAGGCTTCTTAGCGCTCGGTGCCTGGCAAGCCGCTTGCTAGGACCC
AGCAACGATGCGTCGTACCGCTACCGCCGTTAATAAGAGGCACTCGTGCCCATTTGTGTTATAATCTGCTGCTGTTGCCTTTCGAGTTGACCGGTGCTGT
GTATCGACAATGGTGAGAATGTTCGAACAGCAAAAACCGATGTGTATTGGATTCACAGATCCCGGCGACCGGGAAAGCACCGCATCATGCGCTGCCACTT
CTACCAGCGCAGTATTCATGTATTGAAACCCACAAGACAAACGTGACGCGCTACATGTACAGTAGTATTATAGCAAGACCGTCCTATTTGAACTGTAGGG
AGCTGGTGAGGTTCAAGCCACCGTCCAACGTTTGCTCCGTGTTCTTGCCCTCTTCGCGTCCAAGAGCTCAAAGCTCCTCAGACCACTTACCTACTGCGCT
TCCTCCAGCATCGCACCGTCCTGGATTGGATCAGATAGGCGAGGAGCAATTCGCCTCGCACGGTTGGCTCCGTCCAGCACATCTTCATCGTACTCGTCCC
TCCTACAATAGCCACCAGGGCTTGCTTCGCTTGCAGCAACTTCTTAGCTGTCACGCTTCCACTGCATGGCAGTGAGCCGTAGCAATTCTCCAACCTCGAT
GTGCGGGCCACGCAGTATTTCACTGCTCGTCTCTTATCGCCGGTAGATCCAAGATCCCGTGAACCGATAATTGTGGTGCCACTACTTCGCACCACGATAT
CCTTTGCCTCGACGAAGCCCGAACTCGGCGTTGTTCCACTCGCTACCGCCTCCAAAGCCTATGCGGGCCTCATTTCCCTGCTGCTGTCCGGTCCCTTGAT
TGCCGTAGGTCGCGCTGGCACGCGGCGGAGGGACGAAGCTGGGAGCGCCTTCAATGGGAGGCTCGTCGCTCATAAAATCATCGCGCTCCATGTTCTGCAA
CACGAGACGCTTCAATTCGGACTGCTCCTTCTTTCCAGCGTTCTCCTGGCGGTGGCTGTGCTGAGCTAGTGATGACGCCTCGGGCACCACCAATTGGCGC
GCCTCCACCTTGCCCTTGTTACCACGGCGCAGCATGCGAAACACCACACCATCAGCGGACCCATTTGCATCATGGGACAACATGCCACGGGGGCCCGCAG
GGGTAAGTGAAGCCGAGCTTTTCACAACGGCTGGAATAGCCATCTTGTCCACATTTACGCGTGACGCAGGCTTGCGTGTGTCGGTAGACCCATGCATCAT
CGACTTGAACGCCTTTTCAAAATCTTCGTCCTCCTCACTCTTCTGAACGCGGTCGTGGATGACAAGGTGTTCTTCTTCGTCTTCATCGTCTTCCTCCTCA
TCGTCTTCTTCTTCGTCGTCATCGTCATCCTCCTCATCGTCGTCGTCCTCTTCCTCAGCATCATCACCTCCTGCTTGATCGTCTTCATCATGCTCATCTT
CGTCATCGTCGTCGTCGTCCGAATCGTCCTCCTCGTCTTCGAGGAATTCATCTTCATCGTCGCACGGCTGCGAGAGGGACTCCTCCGCTACAGTCTCCAG
ACCATTGGTGGCCATTAGCAGCGCCGCATTCTTCTTTGATAGGCGACGCTCAGCTTCTTCCAAATCGCCACGAAGAATTTCCTGGACGGCTAGGTCAACC
TCCTCCCACGTTTCAAACTTTTTGAAATGGTCCTTCAAACTGCTGGCTAGCATCTCAAAGAGATCGAAAACAACGAAATCGGTTTCCATGGGCACCTCTG
TCTTGGAGAATAGGTATCGCTGGAAAAAGGTCATGAATCGACCGAGCCGGGGTCTGGAGATGCCTCTCTCATTTGAACTGCCATTGTTTCCAGACATGCT
CGGACTTCCGCTGCCATTGCAGGTCTCGATCAAGGCACTTGCCAGACGGACGCGAAACACTTCACTCGGGCCATCCACCTCACTTGGCACGCGAGGGTCG
TACTGCATATCGGGAACCAGCAAGAATCGCTTCTTCATTTCCAACAATTGAACCGGCGATATTTTATCACTACTGTATTGCGGCAGTGTCAGTAAGTCGT
GCGAGTGATTGATCAGGAGGTACAGCGTTTCCACCACCACATTCATACTCACGAGGCCGCAGTTGTAAATCTCTCCTAAGAGTTTAACGTATCCGAGGCT
TCGTTGATGATCGCGGTAGTCATTGACTTCCAGTCCGTACCGAATGTACTCCAGCACGTCGTCTACCAAAATCACCAGTATCTCATCGTGATATCGCGAC
AGCCCCTTCACCACATCACAGATCCATTTCATTTGCATCACCTTGCCCTTTGTCACCTTCAGCAAGGCCTTCAGGACCATCCCGCAGGTTGTACTCTCCT
GCCATGGCAACCGACGGAGAGTCTTCACAACCTTGTTGATGTTGGAGCTGTTGAGGTCTTGGTACAGCACCTTGATCAAGAACAAGTACAGCGGGTCGTA
CTGCTTCACTTGGCGCTCCACACGCTCGGGAGGCTTGCACATGTAGTACGCATTTTCCACGAGTGTCTCCAGCTGCGGGTCCAAATGCTTCGCTGCTTTC
AGCTTCATCATGACATTCAAGCAGTTCACCGTGCGTACGTGTGTATGCTTCGAACAGTACAGGAATCGACCGCAGTTTTCGAGGAACGTCGTAGCCACAT
GGACGTTGTGGCCCTGGAAATCCTGAAAACACTTTTGTAGGCAACGAAAGCCTGTGTTGGGCGGGCAGATCCGGAACTTCACCAACTCGGCTAGAAAACG
GATGTTCTTGATCTTGGATTCAAGACGGAACTGGTTGCGCCTTTTGATCAGGCCATGGAATTCGCCCACAAGCATGCCCACAAGCTCACCACCGATATCT
TCCTTTAGTACGCTTTGCAATGTGGCCACTAGACGCGCGTAGTGGGATAACAGTTCCAAGTGGGTGCGTGGCACCGCATACAGCGTCTTCACCAGACGAT
TTCTCGATGCCTTGGAGTTGCGGTAGCAGAACTCCACCGCTGCCTTATCACAGCGGTCACGATTTACCAGATCTTCCAGCGAGGCGAAGTACGCATCCAG
TTGATGGTGGTAGCTGTTCGTTGCACCGCTCGACGAAGTTGTGGCACTATCACCTACACTGGTATCATCCCTTTCGTCCTTGCTCTTGCTCTCCTCCTCC
TCAGCGTCAGGCGCGGTAGGGTCCTTACCTGCATCTGCTTCCAGATCTTCCATTGTAGCGTCTCGGTCTCTTTTCCGTCCTCATCGGCATTGACGTCAGC
TTCCTCCTCCATCTCTGCTTCTGTCTCTTCTTCTCCTGCTGCAGCGGCTTCTTTCTTCTTCTTGAGCTCGGCAACATCAGCTTCCGTGAGTCCTAAACAA
CTGCAGGCACCAACTCCAGCAGGTCGGGTAGGTCTTCGTAAAATGAGCGCGTCGCCTCATCATCGAAAGGCCCATCGCGGCTCAGCTCACGGCCGCCACC
TTCCCCGCCTTCCCACACGAGAATACCTCCACGACCTGAACCGTCGTCCTTCTCCTCCACAGGGAGCGGCGGGACGTCACGATCCAGCGCGTCTGCCAGC
GAGTTGACGCTCGTCTGCAGCTTCTCAAACAGCAGCTTGGCATTCTTGAGTTCCTGCACGTGTTCGTCCGTCACTTCTCCGCGATTGGCCTCCTCCTTCT
CGTTCCGCGCGTCCAGCTTCAAGAACGTGGCGTGCTGCGCCAAGTAAAACTTGCAGACCATATCGTACGCGTCGAGATAGCAGGCGAGACACTCGTCCTG
CACAGCCTTGGGCACCACGGGCGTCTGCGAGTCCACAAACTCCTGCAGCTCGTCCGTTCCTTCCAGCACCTTGTACATCTCCTTGAACTTCTTGGGCTGC
ACGCCGAGAAAGTCGACGCCTGCCGACTTGGCGAAGCTCACAAGCAGCGGCACTTCCAGCTGCTGCGATGTGCCCGCACTGTTCACGCTCATGTTGCCTC
TGCTTTTGCTCCTGGAGCCTGGCTGCTCGCGCCTTGCGACGCGCTGGATGATGTGCGCGACCACCTGCACGTCGTCCAGGACGCCGGCCAGGCACAGTTC
GCACAGCAGCCGCAGGATGAGGCGGCGCTTGAGCATCTTGCTCTTATCGTCTGAGGCGTACGAGGCCTCGAAGCTGCCCACGAGCGCGCGCGCCATGCCC
GGCGCAAAGTCCTCGTAGCGCTGGTGCAGCCGCGACGCCACCGTGACGGCGGCCGACAGGTCCGCCAGCTTGAGCGGCGCGTCGGCCAGTGCCGCCACGC
ACTCGCTCACGTAGCGCGTGAGGTTGAGCTCGGCGGCGTCGCGCAGCAGCGACTCGGCGTTGGCCTCGCTCAGCATGCGCAGCTTCTTGACGAAGGCCGA
CGAGCGCTTGATGTCCGACTTGAGCTTGAGACGCGATAGCTGCTCACGCACGGCCGCCACCCTGGCCGTGCAGTTGGCGGCGCGGAGCGCGTCGCGCATG
CTCTGTCGCTGGAGCTCCTGCAGCTGCGCACGGGCCTCTTCGTCGTCGTCGCGCGCCATGGGCCGGAGGTGGCTCTTTGGGTCGTCTTTCTTGGGGAGTT
GATCGGATTCGAGAGGGATGCGGTGGACCACATAATTAGAAGGTGGACACTGGAGGACGTTAAAAAGGTCTATTGTTTAAGACGAATCTAGTGTAGATAC
TGTATAGCGAGTTGTTACGCGTCGGAGTCGGGCTCTTGCGGTTTCCGGCACACGCGCTTGACGAATTCGTACGACGTGACCATGAGGATGCCCGACGGAC
CCATAGCCAGTAGCCGCTGCAACAACAACAACAAGGCAAGGAGTTAGCGACTGCAACGTGCCGTTTTGTACAGGGACGTGAGCGCACCGCAGAGAGGCCC
TTCATGAGCCCCATGGGGCCATCGGTCTTTAAAATATACTTGAGGGTGTCCATGGCGCCGTACTGCGTATACACCTGCGCCTTTGTCCGCACGATGTCCA
TGGGGTTCGTCAAGATGCCGGTGATGATGCCGGCGCTCCCTCCGCTCATTCCCTGCGCCACCACTGCAACAAACCAACAACCATGAGTCAAAGTGCCCAA
TCACCCACTCTCTTCTTCCTCTGCACCTTGTTTCCAGAACGGATCCGTCGGCCATTCCTTCATCAACCGATAGTACACGGGCACGAGCAGCCCGTAGGAC
CCCCACCAAATGGACGAGGACGGCGCGTACGTCGCGATGGACGGCACGTAGCCCTTGTAGAACCCGCGCAGACCCTCCGTGCGGAACACTTGCTTGGTCA
CGTTCATGAAGCCTTTGGCGCGCTCGCGCGTCTTGCGCACGTCCTGCCCCTGTCCGCTGAGCATCATGCGCTGCGACACAATGTCCAGCGGCACCACGAC
CGTCTGCGAGACGAGCGACGCGCACGCGCCGCCCGCGAAGTTGGCCCACTTGTCCCCCATCTACCAATAATAACAATACATTAGCACTGCAGTGCACAAC
TGCCCAGCCCAGTGACGGCCGCGCACCGTCGTGTGGTCCCTGAAGACCTTGCGCGACTTCTCGTACACGGACATGTAGAGGTTCCCCGTGAGCACGTTGG
CCGTACTGGCCCCGAAGCCCTTGTACAGACCGCGCGCGCCCTCCTGGCGGAAGATGGTGGCGAACGCGTTGGCCGTGCCCGAGTAGAGCGGCTTGCGCTT
GGACTGCACCTGCAGCCGCGTCTTGACCAGATTGCTCGGGTACACGGCGGCGCGCACGGCCAGGAACATGGTGGGGCCCAGCACGTAGTATTTGAGCTTG
TCGATCTCGTCCCACGAAATGTCCTCCAGCGCGTACTCGTCCTCCGACATGGTGGCCACCCCGCTCATAGCTCGGGCTGAAGCGAAGACTGAAGTTTGAG
GCGGAACGCCGCTGCTGATTTCAGCCAATGAAAACGATTGACATGTTAAATGCCAGACATACTGAAACCAAGTCAAGGATTGATGACTGCCTTTTTATCA
AAGATCAAGATGGCGGACGTGAGCGATGAGGAGCTGCTGGGCGGCTGGAAGCCCCGCATGGGGATGCTGTCCGTGGCCGAGAAGGTGGAGCAGGCGGAGC
TGCTCAAGCGCCAGGGCAACCTGCTGGTCAAACAGAGTGAGTTCAAGCGCGCATTGGCGTCGTACGCCAAGGTCTTCGCGTACATGAACGGTTTGTCCGT
GGCGGGCGACGCCATGTCCCAGTACGCGCAGGCGTCGGCCGGCATGAGCGCCACGCAGGAGCAGGGCGAGCAGATCCAGGCCGTCAAGGTGGCCGTGTGG
GCCAACATGGCCCTGTGCCACCTGAAGCGCGCGACGCCGGATAAGGCCCTGGCCACGTGCGACAAGGTGCTGGCGCTCGAGCCACAGCACAGCAAGGCGC
GCTTCCGCAAGGCACAGGCCATGGTGCAGCTGGCTCACTACGAGCGAGCGCACAAGCTGCTGTGCGAGCTGCTGGAGGACGAGCCTAAGAATGCCGCCGT
GCGCGGCGAGATCCGCGCGCTGCAGGCCAAGAAGCGCGCGTACGACGCCGAGGCCCGGGCCAAGGAGAAGAGCGCGTTCGGCAACATGTTCAAGTAGATC
AGGAAGGAGCAGGACCAATTGCAGACTCAAATGCAGATATCTCGTAGTTAGGCTGCTTGGCTGTTCTGGTCGTCTACAGTCGCAGGAGGTGCGGCAGCAC
GCGACACTTGATGGCCGACATGAACTGCGCGTAGCCGTGGCCGAAGTGGTTCTCCACGCTCGGGACCACGAGGTCCGATACGTCGACGTTCACGCAGCTA
GTAGCGGCGGCGAAGGCCAGAGCTTGGCAGCCCGCGGCCGCCGGGCCGTTCGGGCCCGGCAGTTGCAGCGCCCAGAAGAGCTTGGACAGCACGCCGTCAC
GCACCGAAAACACGTTCATGAACTTGCCGCCGCTCGGGTCCAGGGCACTCGTGATGTTCTCCAGCCCTTGCGCATCTGGGATGAACGCGCCGGCGAAGCT
GACGGCGTTGGCGATCAGTGGCAAGTTGTCTCCTCTCTTCTCCGCGCGTAGCTTGGCCATCTCCTGGAAGGCGCTGTAGATGACCGCACCGCCCAGCGAG
TGACCCAATAGCGAGATCTTGCGTTCCCGCAGCAGCGTCGGACGCTCGGCCAGCACATGAGCGAGCAGCACGCCCACCTGCTCCGCCTTACCCTGCGCAC
TGTGCCACGGGTTGCCTGTAAAGTGAGCGACCATGGACGACACGGACGAGCTACCAAGGTTATCGTTCACGTGCGCGCAGAAGTCGTTCCAAGCGGCGGC
GTCACCGGCCTCCCACTCCACGGCGAAGACCGCGGCGTCCTCGTTCTCCTGGGTCCACGCACGCCAGTTGCGCGTGGGGTCGTCGCCCTGCGTCATGAAG
CCGTTGATGCAGAGCACCACGTGGCCACAGGTGGCTACGTCTCCGCTGAGCAGCTTGAGCTGCAGTTGCTGCACGCGGCGCTTGCGCTTGGCTACGTTGA
GCGTCGCCATGGCGCCGTCGTACGCGCTGGCCCACAACGTCGGGGTCGTGGTCGTGGCCGTCGGCGCGGGCGCGGCCGCAGCCAGGCGTTCAAAGCGCCT
AAGGCGCCGCCCACCGCTACCGCCGCAAGCTCTGCGTTACCGATAGTCTCCTGTTCCTGTTCATTCGACTGCAGCCGCACGCGCTCCACGATGGCGTCCG
CTTCTTGGACCAGCAGCGACGACACGCGCTCACGGAGGGAGTCGGCCGGACTCGTCTCGTACTCCTGAAGTTGTTCGGCCGACAACAGGCCGCGCCGCTG
CAGCTCGCGGCAGTCGGCCAGCAGCCTGTCCAAGTCCGTCATGGATCGACTATTGTAATAGTGACACACACCACGTCTACACGTATTGGTGTATGGAAAC
CCCATGTTGAAGTGGCCGGTGGTCGTTACGCCCTTTGGCGGCACACTTGGTCTCGAGCGGCCGGAGACCAATTCAGTTTGCGCCGGCCATGACGAGCGAC
CTCGAGCAGTTGCCGGACCATTTGCTACTGGCGCACGTCTGCCGCTTCGTGCACCTGCAGGACCGATGGCACGGCCTGGCACGCGTGTCCAAGCGCTGGC
GACGACTTACGCTTGCGTCCGTGCATCGAGAGCAGCACGTGGACTTGGTGCGTCTCATTGGAGCCTTTTGAGGTGTGCAAAGGACTAACCGGTGCGTGTT
TTGGACTGCAGACGTGGTGCACGGGAGAGCATGAGCTGGAGGCCGCGGCCGCCGTACTGCTCGACCGCCAGCCGCAACGCAGCAAAAGCGGCCGGAACTT
GTCGGTCGAGGCATCGCAGCTGCAGAGTGTGGCGCTCTACGGCCCGCGGGTCACGTCGCCGCTGCTATCGCACCTGGTCAAAGGCCTCGGCTGTGAGCAG
CTCCGGCACGTGGACGTCGAGTCCAAGCAGATCTCGGACGCGGCGCTGAAGCAGCTCTGTCGCTGCGTGGGGCTGCAGACGCTCGCGCTGCACTGTATCA
AACTCACGGACGAGTCGCTGGTGGCCATCTCACGGTCTTGCCGCCAGCTGACCAAGGTCGACCTCTCAGGCTGCTCGCGCGTGCGAGACGACGGCATCGT
CGCCATCGCGGCCAACTGCCCCAAGCTGCAGAAGATCAACCTCACCATGTGCCGGCGCATCTCTGACAGATCCGTCATAGCGCTGGCTCAGCATTCATCA
GCGACGTTGGAGGAGGTCGTGCTTGATCGCTGCCTCAAGGTACGCACGTCTGCAGCGTGAGATCGTTTCGCTCGCATTGTCTGATCGGCTGCTCTCCGCT
AGGTTTCTGGGCCGGCACTCCGCTTCCTCATGAGAATGCAGCGCAACCTCCGGTCCTTCTCCTTCGCGCGCTGTCCAAAGGTTCAGGGCGTTGACTTCTA
TAACCTCGAGCAAATAGCGCAAGCAAAAGCGACCATGCCGACCTGTAAGCTCGCCGCATTGGACCTGAGCGGGTGCGCAGGACTGGACGACCGCGGTGTA
GCGGCACTGATCACAATCAACCGGTACACGCTACGCTCGTTGAACCTCGGGGCGCTGCAAACGCTCGGTAGCGCCGCTTTCGCAGCCATCGCGCGGTGTT
CGGAGCTTCAGTCGCTCAACCTTTCGCTGTGTCGGACGCTGCAGAACGACAACCTTGCTGCTATCACGGCCGGGTGCACACAGCTTTCAACTCTGCTTCT
GCAGGGCTGTGTCGCTCTTGATGATGGTGGCCTCAAGGCGATGGCTCCTCGAGCGACGAATCTGCAGCGACTGTCGCTGGAATTCTGCTACAACATCACG
GACGAGGGGCTCGCGGCCGTCGTCTCACGCTGCCAGCAACTGCTGCACCTAAACATCAAGGCTTGCAACCAGCTCACGATCGCCGCCTTCCAGACATTAG
TTCGTCGAAAAGCGCTACTAGAAACGCTGAACATCGGCGCCTGCGCCGATATGGAGACCACCGCCGCGTACTTCTCCATCGTCAAGCACAAGTTCCCTCG
GTGTCGAATCCACTGGGTCTGAGCTGACGACCAGCGTCCTAGAGGCTCTGTGTAGAGTAACAAATATGCATATTTACCTTATCCCTGGTGCAATGCGCGA
CTCTGATAAGACGAGATGGCCGTCGCTATAAGCGGCCAGCCCGTGAGGAGGTTCACCCCGGCATAAATTTAACGAATTTGTAGCGATGACTTGCTTGCCT
TGCGTCTTTCATCTTTATTTATCTGGACGTGCATGGGCGTTTTGTCCTGCCACTTGAGAAACGAGCGTGGGCCGAGCGCAAGAAAGCTCAAGCGTGAAGT
CATCGTCCTCTGCTGTGGAAAACGATGTCGGGCCGCATTCCTAACGTCAGCACTCGGATTGTGCCCAAGAGCATCACACTGCCCGAGACAGGAAGCTGCT
TCGACACTACCACCGTGGTCCCGAAGGTAGGAGCTCAGTGGACATCGCCCGGAGACGATGTCGACACTGATGGTAGATTTATTCATGAACAGCGACGCTC
GAACGAGAAAGTTGACGACTCGGCGCACATCAGCGCGTTCTCGCTGTCCAAACCGACCAAGCCGCACACCACCGACGGCTTCCTTCGAAAGGGCCAAGGC
ACAGGAGGCTCAATAGACTTGGAGAAAACACTCAAGGTCTGTGGGGATTGCTCGAGCCAACAGTGGCGAGGAAATACGCTCACACCGTTTGATTCTAGGT
TGACAAGTACGAGAATGTGTCTCCGCGCTCGCGGCACCAGCAGCCTGCAGCATTCCGAGAGCGCGCTAACCCGCCCGATACGTCTTTCCGAAGGTGAAGC
GATAGAAGGGATTTCATGGTTGCGCTTCAGAGTGCTCACGTTGTGGTGAAATTGCAGATTTTATGAGCGTAGCGACCTGCCGATCCAGATTGACCACGGC
GGCGTGCGCAACATGGTAGCCTGGAAAGTGGACATCACCAAGGTATGCGGTACAAACTCAGCGTCCTGGACTCGCGTTCTAACCGAATCTGTGGGTTTCT
GTAGCTCGACTTCCACCACTACCTCCCGATTTTCTTTGACGGACTCCGAGAAGTGGAGGAGCCGTATGCATTCCTATCGGAACAGGGCATCAAGGACATG
CTCATCAACGCCAGCAACAAAGTGCTGCCTGTCATCCCGCAGCTTATTATCCCGATCAAGAGTGCGTATTTTCAGACAGTTCTCAAAATTCGGCTTGGCC
TGACGTTCTCGTTGTGCTAGACGCTCTCAACACGCGAAATGCTGGCATCCTGGTCAAGACACTGCGCATTCTGCAGCTCATGGTGACGTGCGAGTCGGCT
GCACAGCCAGGCACTGGCCCGGGACTAATCGGCCAGGCGCTTGTGCCATACTACCGGCAGATTCTACCCGTCCTCAACATTTTTATTCGCAAGAATGGTA
CGCAAAACGATTTTCTGCGAGGTGTTGCTAGTGACTAAGCTTTGCACACGCTTCGGTTTCTGCTACAGACAACATCGGTGACGCCATTGACTACGGTCAG
CGCAAGCAGTTGAATCTCGGCGACCTTATCCAGCAAACACTCGAGATCATGGAGTCTCACGGAGGAGATGACGCTTTCATCAACATCAAGTACCTCGTCC
CCACCTACCAGAGCGTGTGCGTGGGCTAGCCTCGCAACGCCGAGCGTATCCCAGCTAGCAAGACGAGAAAAGCGTACAAGGTAGATAGCGAGCAGCAGTC
TTTGAAATTCGAGGCCCCAGCAAGAGTAAAGCAACCAAACTTTTTCTGGTCACTTGTTATTCGTCATGTTTGCTTCTTCTTACTGCTTTGGCACACCGTT
GTTTGTTACAGCAACATATTTCTTCTTGTACCGCCTACTGCTGCTGACTTGGGGCGTGGTTTCACTCGAGGAGGAGGATCTCGGCGGCCAGTCAAGGACT
GTGCATTGCTACTGCTTGTGCCTCGGCTAGTGACAGGCGCTGCCATCTTCGAGGGCATTGGTGCTCGTCCGTCGACTTCAGTCGGAACTTCATCAGTCTC
GGGAACTTCTGCGGTCAAAGTGGACTTTGCTTCGGTCCGACTCGAGAAAGCACCCGTGCAGTTCCACCGCCGCCCTTCACCCCAAGCTCCTCGTATCGCC
TCAGTCTACGCTCCAGCTCCTTGTTCGCTTTCCGATACGCGTTCAGCTCCGTCACCAGCGAAGAATTTTGATACGACAGCGCTGCAGCGAGTTTGTGTTT
CTCTCGGTTACCAGCTTCCACTTGGCGCCGCAGCGAGTGCTTGTTCTGTAGCAAGAAGCGGTTTTGACGATGCAGTTCAGCATTGACCTCGCCGGCTGAG
TCTCCGCGAGCTTGCAGGGCGTCCAGTTGCCGCGTCAGGCGCTTATGAAGACAACCGATCTCCGTGACGAGAGTGCTCTTCTCCTGCACGGCACTGCGTC
GAACGAGCTCGCCCAGTTCTTCTTGTAGCACCACAATCGAGTGTCGGACTCGCTCCAACCGCTTGAGGGCTGCCTCCAGGTCGCGCGCGTGCTTTCTTGC
AAGCGAAGACGTCTCAACTCGCAGTCGATCGCTGATGTTTGCCTGCACCACAACCTCTTGGTTGGCGTCATGCAGCTGGTTGAGGTGCTCTTGCATGTGT
ACCAGCTCGCGGTCCTTGGGGAGTATGTGCTTCTGCAGCAGCTCCAGCTGTGAGCGGTGTACGCCATCCAGACGCTGCAAATTCTCCAACACGCGTCGCT
GCTCAGCGAGTTGGGCTGCACCTTCCTCTTTCTCTCGCATGATTCTCTTCGTAAGAGCTCTCTCGTCCGCCAGCTTGCCACGGAGAGCTTCCATCTCATG
CAAGCGTTCGTCGTAGTCGCAGCACATTTGCTGCAGCTCGCTGTCCTTGTGGTTGAGGTCTCCAAGCAGCATCTTGACCTCTTGCTTCAATGCTGCCGCC
TTCCCATGCTGCTCGGCGAGCTGCGTTGCGCCCTTCTTCTTTTCGAGATCGATGGAGCTAGCTAGCTGGCCCATTTGTACCAGTTGGTCCTGGTCTTGCT
GGCTGAGCACTTCCTGCAGCTTCCTCCGAGTCGCCTCCAGCTCGTCGACCAACTTGTTTTGTGAACTGTCAAACTGGACTTTGGCCTCTCGAAGCTTCTT
CCTGCCTTCGTACTCCAGCTGCGTTTCACGCTCTTGCGCTCGCTTCTGCTCGTCCTCCAGGTCAAGCTGCGTAGCGTGAAGCTGTTCACGCAGCGTGTCA
CATTCAGCTTGCAGTTTTTCCAGAGTTACCAGGTAGTGATCTTGAGCCGAACGAGCGTCTTCCGACAGCGAACGCAGCTTTGCTTCTCGGTCGTGGATAG
CTCCGCCAAGACGAGCGTCGAGAGCCGTACACAGCGTTTTCTGTTCCTCTTCGGCCGTCCGAGCGTGGGCTTCAAGCTGGCTTTGCAATGTACTTTGGAA
TCGTGTCCGCTGGTCACTCGCTTGCCGGCTCAGCATCTCGTTCTCCATCTTAAACTGCTGCAGCTCGCCATCCAGATCCAACAACTTGAGTCGAGCCAGC
TCTACCTTGCTGCGGTCGTACACTGCTAACTCCTCCGGCTGGCAAATGCTCGTGAAGGCATTAACGGACAAGTCGTGGAGGTGTTGGTCGTCTCGAATTG
CTGTCGCTAAGGCTGAGGCGCTCTCGGCAGCTCCAGAATTCTCTCGACAAAGCTTGCAGGCTAGGACAACGCCGTTCTGAGCGTTGGTGAGTAGCAATCG
CGACCGAGCAGTGTAGAACAAACCTACTACCGGTGCCGTGTGCAAGTCTACACGCCTAATCGCGTGTGTGAGCAGGATGGCCGATCGACTCCGAGCTCCT
CGCTTCCAACTGAAGAGCACCACCGAACCACTCGCTGTGCCGACAAACAACAGGTTCGAGTACATGTTGCCATCGTTGCCTCCCAGTCCTCGTCCTGCCT
CGAGCGCCGTGATCTCAAACGCCAAATTCTCGCCCACACCGCCGCCAGTGGAACTATGAAGCGCGTCGGAGGTTAATTCGCCATTCACCCATGCACGCAC
AAGGCACTGGCTACTGCTCGCTCGCTTGTGAGAGCCTGACACCCGCTTCTCGCTACAAACACTGCGTAGTCGTGACTTTCGTGGTCCATGTAGCTGGTAG
TAAACGCCACGATGGCGTTGTCCGGCGCAAGTGTCTGCGCCACGCTGTGTGTCCCCACAAGGTCTTCGACTTCGCCCCCGGCTTGCCAGCGTAGTTGGCA
GTGGCGAAGTTCTCCGGCAGCATCGACGGCGAAGAAGCTGCTGTCATGAACAGACCAGCGGAACAGCTCGACGGTGTCGCGGAAGTCTCGAAAGACGCCA
ACGAGCTGCGGCTCTCGCTGGACCCGAGACAAACCTCGATACACGAACACTGCTTTGTTAGTGGCGTGTACAGCTGCAAAGAGCGCGCCGCTGGGACTGT
ATTGAGCCAGTGAGAGCTGCTTCTGCGGCATCTCGAAGGCCAAACGCAGCGAGTTTTGCAGCACGAAGAAGACCTGAAGCTTGGACGCGAACGTCACCAA
CAATTCGGAGCCTGCGGGGTGAAGATCAAGGCTCAGCGGCGCTTGTTGCTCTAGAAGGTGAACCACAAGGCACTCGTGGCAGTCGGTTTGGCTCCACACG
TGGACGGCTGCGTCTCCGTCCGGGGACCGACAGGCTGCAGCGAAACACGGACGTCTCGACGCTGCACTCAGTCGCTCCATTTGCTGGGATAACGGCGTGG
ACGCCAAGACACTCACGCAATTGTTTCATCGTCGCCGCGGAGAAGGCACAAATTGCTGAGGTCGTAGGCCCCGTAGCCCTTTTCAGTACAACAAAGCAGC
ATGGCGGCGGCGGGGTCTGTTGTCACGCTTACGATACGCTCGCTACGAGTACAAGAAGCGGTCGAACGTCAGTACCCCGAGCGAAATCAACTCGTTAACC
TGCACCCACGTACGTGTTTGGCACTCGCATGCGTCGCTGGAGATGCAGCTCCTTCTCGTTCGCCTTGAGCATTTTGGATGCCACACGAACGACGGACACG
AGTCCGTGAGTGCCTCCGACGACAACTCCCTCGCCGTTGTTCAAAGCGCTCATGCACAACAACCGCCCCAAGCCTTTGTGTACTGCACGGAGCGTCTGGA
TCAACTCGGCATTCACCACCAACTGCACGTCGCCGTCTTCCAGCAGACCAACCAGCACGTCGTCGGGCAGCCACGCGTGATCCGCGTAGCTCACGACGCT
TTTGACTTTGGTCTCGTCGCCCGACTTGAAGCTCGCCAGCGGCTTGAGCGTGTACTCGCACAGCGTCCAGAGTCGCAGCATATTGCCGCCGCTCGTAGAC
AACTGAGCCATATCGATGGGGTTGAAGCGGACTCGGGACACCCGGCAATGGACATCGGTAAGAGCTACTTGCCTGCCACGACCCCAATCCCACACGCCCA
AGCTCCAGCTCGCGTTCGCAGCCTGACCGCTGACCAATTTCCCATCAGGAGACAAAGCTGTTCCTACGAACCGATCCGTCCAGGGCACGGTGAGAGTCTT
GAGCAGGACAATGCGTCGACCTTTGCCTGCAGCTGGGTCAGGTTTGTCTGTTCTTGTTGCAACGCTGTAGACAGCGATGGAGGCTGGCGAACTGGTACTC
TCTGCATTGCCATCGTCGGCTTTCACTGCAGCGCGACAAACCGAAAGGTGCTGGCGTTTCCCGCACAGCGCCATCGCTGTAATCTCTCCAAGGAACCCGA
CGATTGTCCTTGGTCCGTCACGAAGCTCAGGTCCTGTGTCTGCGTGTTCTGGAGCACGACGTACTTGCCGATGGCCAGCACAAGCTCCTGACGACTCAGA
GGCAGAATGACGTCTCGGAAGGACGTGTCCAGCCCATTCCCATTCACCGGCACCAGCGTCGGTGGAGATGGAGACGCACTCGACAGAGCCTCACGCATGT
TCGATAGCAATGGACACGCTCGGCAGGA