Description :
From Genome Similarity Track
Location :
Scaffold_552:4390- 7336
Sequence
2946 bases(100 bases per row)
ACGCTTCGTTGAATCTTTTGATCGATATAGCATTCCAGCAGTGTGTTCACTTCAACGCTTTGATTTATAGTATGCGTAGGAGCTGACACCAGACCTTGTG
GCGATCCAATTAGCTTTAGGTGCCAAATCTCTAACACAAAATCACTGACAGCAACGTCTTTAAATCTCTCTGTGAAAATTGATGTTCATGCCACCTTTTC
GTTTCCAAACCGCGATCAGCCGAATTCTTCTTTTGATCGTCTTGGTCTAATCGAAATGCCTTTATCTTCACCCGCGGCGGCTTCAAACTATTTTTCTTCA
ACCTGGTGGGGGAGGTTTTTTTGGTTGAAATTCTTTTAGTTTTTACTGTTGGAATTACATCCAGCGTATCGCGTTTTGCGGAGCGATCCACAAGGATCGC
CGAGAGGGCCTCGTGAGGGGTTTGGGTTTGTATTCCAGATCGAGCGATCGATCTTCCTAATTAAATATCTTGTCAGTAAATTCCATCCCCACAATCTGAC
GATCTAGAGATCCTTTGTTTTACAAGTGTGCGGCAATCTCTCATCCACTGATGCTTCTATCCCAGGTTCTTTCTTGATCGTGACATCTTCTACGTGGGAA
TCAGGGTGGAATCCCGAGTCACCAGAAGATCCGGGCACGTGCACCACTGTGGTGGAGTAGGATTCGCTCATTTCATAGGCGACCCCGACTCTCCACTGGC
GCCCAGACGACTGACTAACGGAGGAAGTACTCCTATTCCGTGTTGTAAACCTTTCTCACTTTGTGTACCCGTCGGTAGAGCGGGCTGCACTCTTCTTGGT
GGACTTGAGCCGATGGCAAACCTGACTGTGGTTGAGATCGGAGCCGATTGCGTAAAAATCTTCACGCAATTGCGGTGTCCCTGGAGGACTCAATTCGAGT
TTCCCGGATCTCCGTTGAGATCGCATTGTCCAAAGTTGGTAATATATTCGCGAGCCTTCTGACCACTTGAGTCGTCTCGCGATCTTGTATCAAAGCCACT
AGGGTTCAGTGCGTTCGATCGCAGTTGGGTGTGTGTGAGAGTTCTTGCACTCTGGCCAAATAATTCAGGAGTAGAATTTTTGGAACGTAGTTGAAGCTCT
CTGACGTTGGGAGGCCAAATAATCCTACCCGGAAGGAGAACGACACGTGTGTACTTTGAAGTTAGTTGAACTCTATTTAATATTATCCAACCAACGACTA
AACTATTACTATGCTTACCCCGTATGTCAGGATAGACCGCCACGTGTTGTCTTTATGCTGAATGTATTTGTAATCTTCCCATATCAGGTGGCCCACGTCA
GGTCGCGGTATGCGATTGGCTTTGATCACAGTTTCAGATTGCGGTGCACTATCGTGATCTTCATTTACACATTTACACTTCTGGTTCGCGGTACGCGATC
GTGATCCTGGATCACACTTCGTATCGCGGTGCGCGATTGCTTGCCTTGATCGTGACGTATAATAACTATGCGTTATCGCGATTTGCGGTTCGAGATAGAT
ATGTGGTCGATGCTACATGTATCTGTCCTTGTGTCAATCCCAATCCAGATCACGTCTGAGTGGCAATCGCGTCTGAGTCCGCAATAGCAATCTGGTTCGG
CCCTTTATCGATTGACGTCTGCGTCACAACCACTTGGAAGAGTTGGCGCGGGACAGGGTTTTCCCTTCAGCTGAACAATGGCGACGAAAATTACCAAACT
GTGACGAAAGTCACCCACGGTGATGGAAATGTATGCTTCCCCACTCCAAAACCATTAATCAGCTCTTGTTTCGCGCTTGGCTGTGAACTGCTGTCTTCTC
CTAACGATATGTGGTCTGCTTTACCACACTTACCATCACACCAACAAAATTTCGCTACTACCCCTCCTAGTCGTTAAAGGTGTGAAACAGTCGATTTATA
AGCGCGGCGTGAATTACCTCCCGCATGAAGAGCAATCATGGATTCGGGGTTCCCGCCCTGGACAATGGTCAGTCTAGCACCGGTCCAGTCAAGTGGCTTG
AGTTCAATCACCTCCCTCGAACTTTCAAGACCACCCAAGGTCATTAAAAATGTGTGCCACCACCGAAGTCTCAATGATTCCACCCAGGAATCCTGGTACC
ATTGAGATGTAGTCTCTCAAAGAAGCATGAATCTCGACAAAGAATAGTCAGGGCCCCTGGAACTGACTGGTACACATAAATCCGGCAGGTGACAGGCTCG
TCGTGCGGCACGATATCCGCGAGCTGGTTAAGGGATGTGTTGTCCCTACCGAAGAGGGCGGTTATAGGTCGTTCGAACACCTGAATGAACCCGCCGTACC
TAAAAAAGGAGCGACCGTGGATGGACATAGAAATACTGATTAAGTTAATTGATCTGATGTTCCTTGCAGTTCTGGACCCCTCTGGCGGCAGAGACCTCGC
GTAAAACTCGATGTGAGCGCACGTAGAGGAGACGTCAAGGCAAATTATATCAGCCAGAAGACCAGGTGAGGGTTATCCCTGACGCCGTACCTGCAGGCAG
GAGACATCGGTGCCTGCAAGCCGTTCAAAGATTGTCTCGTTAGCGTGGTTGACGAAAGAAAATATGATCTGACAGACAATCGATGGGCTAAAATTCGCAG
CCTTCGATCGCAGAGGAGGTTGTTTTGGCTCGGGTCTGTACCATTCGTGGAAAGTTTTCCCTAACGACGTCGTGCAATTGTCAATTACCCCAGCTTAGTT
TGCAGTCGACTACCGCAGCTGACTCCATCGCTAACGCGACATGTACGGCGGTCTCTTTCGAAGTGTGTGGGTAAGCGCTGATGAAGAATCGTCCGATGAT
ACAGATAGTGATGGTGGTCGTTGATAAGGGCATTGCTTTTTGTGTTTGGGCAGCGCCATATATGATTTGTATTGTATTAAATCTGACTCCAAAGGACTCA
CGTGGCAGTTCCATATCCTAATGTGGGAAATCTGTGTGGTCACTGC