Description :
From Genome Similarity Track
Location :
Scaffold_1857:439- 3121
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1857-snap-gene-0.1Protein kinase

Sequence
2682 bases(100 bases per row)
CGGCGACGACGAAGACCGGTCNNNNNNNNNNAACACGCTCGCGACGCTCTCGCTCAACACACTCACCACGAGCTGCAATGGTGGCTGCAGCGTCAACAGC
CCGTGCGTCGTGCTCGGCCAGTCCTNNNNNNNNNNTGCGTGAACGACGTGCGCTGCGCCACGCTGCTCAACGGCAAGACAGCATTGTGTATGGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCAAGAGCGACGATGCCTCGGGTGTCGC
CCCCTTCGAGCGCGTCGGGCTCGTGCAGCTCGGCGACCAAGTCACCGAAGTGTGCGTGTGCTTTTCCATGCTCTTCTATCCGATGTTCACTCTTGGTGTG
ATAATTGATGATGATAATATTGATCCTCGTCAATTAATTGTTATAATTACTGCTGATTTGTGTAGGGATTTTAAGATTGCGGCGCCGGCGATGACTCCGT
TGACAAATTTGGACATCTCGTCGCTCAATGTGCAGTCGACGACGACGCTCACCAAGATGTGCGTTTCGTAATGCTTTCCACACCTTTCAGGCCTTCAGGA
GGTCTTATATGTCAATTTTGTGTCTGTGATTCTGTGTGCGCAGCTCCTTCTCGGACCTCATCCTCACGGGCATTGACGGCGCTCTCCCGTTAAACGGAGC
CAAGCAAATGTGAGTCCCTCTTCTGTTGCGTGTTTTGTATCTGAATAGTAGCCTGACTAATCTTCACGATGTTGTCTCTCACTTATGCCCCACAGTGCCA
TCAATAACTGCCGCCTCAAGACCATCCCAACCCAGTTTATCGCAGGCAACCAAGTCGCGTCACTGTACGAACTTTTGCTGAAGTTTGTGTTCATCTTGCT
AGCATGTGCTGACTCATGCCTTCATTTCATGTAGCGACCTCTCCAACAATGGCATTCTCATGGTCCCGACGGATTTTCAGAACCAGAGTTTCCCTACACT
CGCAGCGCTGTACGTTCTTCCTTCTGTATTCTAGCTGATTTGATCACCAAAAGTCACCAACTGATGCTGCTTTGGTAGGGATCTGTCGAGAAATGCGCTC
ACGACGTTCAACATCCGTCCGTCCAGTTTCCCAGCACTCACGTCGCTGTACGCTCTTCTCGTTGTATATTTCCTTGGATGCTCAACTGTGTGGAGTCTCT
GACTAATCTGTCTCGTGTGAACACCAGCATTCTCTCAAACAACCAACTCCAGACTTTCCCGACAGTGGTCTTTAATCTGACAACATTGCAGCAACTGTCG
CTGAACGGGAACCCGTTGAACGCGTCCACTTTGACCGAGGAACAATTCACATTCCTGGCGAACCTGCCGTTCTTCTCCANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCGACGTGTGTCCAAGCGAAGACGTGGTGGCGAAGCTGAACAGCACGTTCACGTTCTGTATGCACGGCAACAACAGCGAGGATATC
ATCAGCGTCATGCCGACGACGGAGCCTCCTGCAACCGACGCGCCAGTCATCCAGACGTCTCAAGACAGCTCGTCGTCCAAGACGTGGATCTGGATCGTCA
TCGCCATCATCTGCGTTCTGCTATTCGGTCTACTCTTTTTGCTGTATCGACGCAAACGACGGCGTGAGGAATCCCCAAAGCTCGCGAACAGCATCACGCC
GTCGATCGCCGTGGGCATGGGCGATCTCGCGGACCACCCGTACATGGAGCTCAACCCACCGTCGAGCTGCAGTCAGACGACGTCGGACTTCGNNNNNNNN
NNNNNNNNNNNNNNNNNNNGAATGTCGCCGACGGGTACATCGCGCTCACGCGGCTCTCGTACAACGACGTGTTTCTGCACCGCATGATCCGCGTGAGCAG
CAGGTCGGAGCTTTGGTTTGGCGAGTACATGGACGAGTCGGTGATCATCAAGAAGATCAAGAGCAACGCGGCATCCAAGACGGTGCTGCGCGAGTTCGTG
ACCGAGATCGAGCACATGGTGGAGCTCAAGCATTCGTGCATCGCGACGTTCAAAGGCGCCATGTGGGACAACGAGGGTACGGAGCTGTGCGCCGTGGTCG
AGTACGTGGAGAACGGCGCACTGCGGGACTGCATCGCGAGTTCCGTGGGACTCTCTGTGTCCAAGCAGCACGCGATCGCGCGTCAGATCACCGACNNNNN
NNNNNTGTTTCTGCATCAGAAGCGGATCGTGCACGGCCGCCTGAACTCGTTCAACGTACTACTCGACAGGGACTACTCGGCGAAATTGAGTGTGTTTTCG
ATCTTCCACTACGTCAAGTTGTCGCCGTTGGACGCCGAGTGCGGCATCTTCGCGGCGCCAGAGGTGCTTCGCGGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNACGGAAAAGTCGGACGTGTACTCACTCGGCGTGATCCTCGTGGAGCTCGACACAGGCGAGAACCCCGTGGTGAACGCGAAGCGAACCGCTGTCGCT
GCGTCAGCGTCAGCATCTCGGAAGGACAATGAGTCTGTCGTGTCGCCGACGTCGCGCCAGATCGGGTTCCGACTGAGCATGCACTGCTCACCTGTGCTCA
AGGAGATCATTGTGGCGTGTCTCGAGAAGGAACCCACGCGGCGCCCCAAGATGAGCGAGATCGCGTTCGCGCTGCAAACCGG