Description :
From Genome Similarity Track
Location :
Scaffold_1446:439- 3046
Transcript NameFunction/comments

Sequence
2607 bases(100 bases per row)
CGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAATTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCA
GCTTTTCTCGCTTGCGCCGTTCGCTTCTCGTGCGGAGCCCGACTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCC
GGCGGATTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGT
GCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCA
ATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTCCACA
TCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCTCATCCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGT
GGTGCATGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGA
TCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCTAGTTCTAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGA
AGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAG
CCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACA
AGGTTCGGCTTGTCATCTTCTTGCAGTGAAATTGACTCTCGCTGGGGGCAGCGATCTTCAATGCAGCGTGTCTGATGTCGACACGCTCAATCGCATCACC
AGCAGGGCGCCCCGCGCCTGCTGATCCGTCTAGTTTTTTGTTAGCCCGTGACGATACACAGTATCGCCACGACGGCTCTTCGCCGCGTGCACAGGTGCTG
TGCACTCGCGAGCGTAGTGACCAATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCCGTCGCACTCGAGAG
GTCCATTGGTTCGGGACCTCCCGACGGCCGTACCACCGGTCGTGGTATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCT
TGCATTGCGAGCGCATTTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATATGTCTTCACAGGCTCATCTCTAAGGCCCTTCATGAACGTGACGA
CCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGTGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGGTC
GAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCC
GTGAGTCGGCGTCCGTCCGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAA
TGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGAC
GGATGCCGACACCGAAGCTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAAC
ATCGTTGCTACCGCCGTTTCTCCAATGACCGTCGACTGTCGTTGGAGGGCCCCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCATGCACAACATGCG
TTGCAGACGTGTTTCGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGT
TGGACGGACCAACAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAAGAAGCGTAGGAGTAAT
TTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACTAAGACAAAGGAACCGAACAATAGCTTTGGTGCCAAATGAGAACTGTATAGATTGTA
AATGGGGTTTCCTCCTCAAACTGTTATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAG
ATGTTACTTTCTACCAGTCATATGCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCAACTTGAATGCACCCATTAGTGCATGCTGCACTAAGATA
GGAGGTG