Description :
From Genome Similarity Track
Location :
Scaffold_979:439- 1989
Transcript NameFunction/comments
Phyag_g8956conserved hypothetical protein

Sequence
1550 bases(100 bases per row)
ACAGTTCTATGGGTTTGTTCCGTGACGGAACAAGAAGCATTCGTCAGCTCACGTTGAGCTTGACTTTAAGCTCCAGGTGACCGCCTTGAGATGCTCTAGG
TACCCACAGTACCAGTGAGCCACCTCCTGTGCCAGGGATACCCAGGAAGCCCGGACGCCAGCGATCAAGGTACAGCGTCTTGCCTCCTAGTTTCTTTACG
GTGGACTTCCACCTGGCGGTGCCTCCAGCTTTGACGTCCACCTCGCCGATTTTGTCACCGCCGGACATGATGTTCACCGTCACGTCTTTcgtgtcgctgc
ttgtgAAGTTGACGCTGACCACACCATCGCCCTTCCTGACCCATGAACTCGAGCTGCCTTTGAAAGCTCTCTGTAGCGTATTCAAGCCCAGGGTGGCGTC
TTCCgtgccgtcgtcgatctcgcccATGAACTGCGTCGGGCCACAAACCGTCTGAATATACTcggacagcagcgtcgcgaTGTCGGTCGGGTCGATCATC
GAAGCGGAGATGGTTGAGAGACCGGTATCGATCCACTTGTAAGCGGccgccttctcgtccagcgacgtcCCGTTGTCACTTTTACCGGACTTGATCAGGT
CGTTGATCATGACTCCGAACGTCTTGCGCAACGACTCACGGGTTTTGTAGGCCGTTTCGACACTGGATTCGGAGATCAGTTGCtgcatgcagttgttggt
gacggtggcgacgtCGTAGAGTACCAGATCGGACTCACTGACCTTCAGTCGGATCTCATCATCGGTAATTGTTGGGTCATCCTCTCGGTACTCGTTGACA
GTCATCCAGACGCGGTCGGCCAACGACTTCAGGTCGCCGGCACAGCTCGAATTTTGCTGCATGGCCGTCTCGAGTGATGCGATTTCTCCCTCCGTGATct
cttcggcagcttcggTGAAGTTGGCTCCTTTGATGAACGCTCGGAACCGCCCCCAGCTCGAGAtaatgtcgtcgtcgtaggtgagagcctgcagcagcat
ccactGCGACGTCGCCAGCACGATCTGCGAGAGTCGGAGGTTCGAAGGGATGTTCTTCCCCATACACGCGTAGATGGCCATGGGCAAGTCGGTCACTACG
TTGTTGGTCTGGTACAGCATCAGCAGAAGCTTCTCCTGCGACGTCTGCGGGTCTTCCGTCTTGACGTTGCGGACGTATCGGATGATACCTctcatcacca
gcaacaactggTTCGTGCACTTGACGGCTCACGTCAACTTCTTGCCTAGTTTCACCATTTCGCCAATGACACCGAAGGTAGCCGTGCCGATAACTGCCAT
CGCCACAGCCGACACCTTACTAGCAACCTCGAGTCCACAGTCGCTGTTTTGTCGGATGCACTCCATGCCACACTCGACAGGGAACTCCATCGGGCATTCC
GTCCAGCACGTATTCGTTGCCTCATTGCGGTCGAAGTTGCTAGGACACGTGTCCATGATGTGGGCTTCTCGGTAGCACGACGTGTCGGACGAAAGACTCC
AGGGACCCACCCAGTTGCGGTAAGTCGACCTCACAGTActcgtggcggtg