Description :
From Genome Similarity Track
Location :
Scaffold_1425:439- 1602
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1425-fgenesh-gene-0.0Phosphatidyl inositol kinase (PIK-A)

Sequence
1163 bases(100 bases per row)
GGAACGAGTGGCTCTCGTTCCCCGTCAAGTACCGCGACCTCTCGCGGAACTCGCAGCTCGCGATCACGGTCTGGGGGGTCGGCTGGGAACCCATTGGCGG
CACGACCATTTCGTTCTTTAACACTCAGGGCGTGCTCCGCGACGGCATGCAGTGTTTACGCATGTGGAAAGGCGTCGAGGCCGACCCGTCGCCGTTCACA
ACGACGCCGTCGGAGGTGCAGGGCGAGTGGACGCGCCAAGAGTGTTACCGGCTTGACAAGCTGCGGGAAAAGTACGAACGCAAAGAGATCTCCCGCAACG
AGTGGATGGACGGCGTGACCGACCGACGCATTGCGAGGATCCGCCGTGGCTCCGAGCCGCCGGGCCGGAAAGATCCGTTGGGGCCATTCTGTTCGTACCG
AGAGGACGCTGTGCTCTGGATCGAGATGCCGTACTTTGGCGATGCTGTCGTGTACGAAGAAGAACCGTACGCGCAGCGCAGCGCCACCAACAATTTGTTT
GCGAAAGAACATCTCAAGGTGCCCGGCGCTGCCACCGTCGCCGCAGCCGGAATGGGCGGTCTAGGCGGTGCAGCGAATGGCGGCGCGAATGGAACCACGT
CAGGCGGTGTGCCTGGCATGTCGCCACCGACGATGTACGGTGGCGATACCTATGCCGGTATGTATGACAAGACCCGGGACGGACCGCTTGCCGGTGGTGG
ATACAGTGCCATGGTCGTGTGGGACCCGGATATCAATGAAGAAAACCCTGCGGAACGCAAGTATCGTAAGCTTGCGCGCGACATTTTGCGCGGCTCGATC
GATCCCAACCTCAAGCCCAGCCGAGACGAGAAGGCGCGCATCGAGGCACTGCTGGCAATGCCCACGGACAACTTGAAGAACGAAGAACGGGATTTGCTGT
GGAAGTTCCGGTACACGCTGACCGACAACAAAAAGGCCGTTGTCAAGTTTCTGCTTTCCGTCGACTGGAACGACGAAACCGAAGTCAAGCAGGCGACCGA
TCTGCTCCATCAGTGGTGTGAGATTGACATCGCCGACGCACTCAAGCTGCTGGGTCGTGAGAAGGAATTCAAGCACGAACTCGTGCGCCACTTTGCCGTA
TCGACGCTGGCTAGAGCCAAGAACGAAGATCTCCAGGACTTCTTGCTGCAGCTCGTGCAGGCA