Description :
From Genome Similarity Track
Location :
contig_22:438977- 459902
Transcript NameFunction/comments
g5942.t1hypothetical protein
g5943.t1hypothetical protein
g5944.t1hypothetical protein
g5945.t1hypothetical protein
g5946.t1hypothetical protein
g5947.t1XP_009532150.1 hypothetical protein PHYSODRAFT_517693 [Phytophthora sojae
g5948.t1hypothetical protein
g5949.t1XP_009532147.1 hypothetical protein PHYSODRAFT_516298 [Phytophthora sojae
g5950.t1XP_024573246.1 Uncharacterized conserved protein [Plasmopara halstedii
g5951.t1hypothetical protein

Sequence
20925 bases(100 bases per row)
TAGACGAAAGCACTTGGCCGCCACGCCGAACGCACTACACGTACCAATGGTACTCAGTACTAATGACATCCTCGAAGATCAGCTGTACGAGGGTATCCGG
TGATACCAGCGTCAGAAGCTGTGCTCTCGAGTTCGACGCCATCTTGAAAACCTATTGAAGCTATTGGTACAATGCTGGACGTCAATAGACACCAAACAGT
TTCCCAAGCACTGCACCGGACCAGACCTCTCTGAAGCATTCCGGGATTGGCCATCGATATGTGCCGAATTGCGCATTTTGCTTCAGAAACCATATTGTGA
GAGTGTTACGATCCACCGCAGGGGACAGCTCAACGGCAGCAATTCGCTGCATGTGCCAGGTCGATTGCAAGCGCTGCCGTCTCCTCATTCTACAATTTCC
TCCGCTTCACGCAGACGACTAGACACCCCAGCCTCCAGGTACTCACCATGAACGCGCAGACCATCCTCGCCGTTGCCGCCATCGTTCTCGTCGGCTCGGC
CGCCGCCTCCAGCTCCTCCAGCTCCGACGCCTGCTCCACGACGCAGCAGACCTCCGCCTACACGACACTGGCCAGCCTGCTCACCCTCGACTCGTTCCAG
GGTTGCGTCGACGACTCCGGCTACAGTCTCCTGTACTCCACCTCGTTGCCCACGGACGCCGAGTACGCGCTCATGTGCGCGTCGAGCGACTGCCAGTCGC
TCATCGAGTCCATCATTTCGCTGAACCCGCCTGACTGCACCCTGGACGTGCCAACTAGCGGTCTCGAGGTGAACGTGTACGAGCTGGCGAACGGCTTCTC
GAGCATTTGTTCGTCGCTGTCGAGTGACTCGTCGACCAGCACAAGCTCCACCACGACCACCACCGCGACGTCCACGGCTGCCAGCACGAGCACGGACACG
ACTTCGACCACGACGACTGCCACCACGACCACCTCGTCGGCTGCGACGTCGACGGCTGCTTCGACGGCCAGTGACGCCACCACTTCGTCCAACTCGACGG
AAACCGCAGCGACGGCGTCGAGCTCGGACTCCACGGCTACGACTACCACGGCTACGGCCTGCTAAACAAGAGGCGCTTGCTTAGCTTGGCGTCTTCTGGC
ATGAGCTTCTCTTTTGCGGTATGCAACGGACTCCGTAGCACGTAGTCTGGACGCGCAGGTAATTTGTACGGAGTGAACGCTAGCATTGTCGTCTCCGGCA
GTGTCCAAAATATATCAAGCAGTGCCGTGTATGTGATGCGCGTTCCTTCTACCTGAACAGCGCATAAATTCACAGATAAAGAATGCGCACAGGACTGAGT
AGGCCAACCCCTCCGCCCAGTGGGGGTGAGCGGATGTCCCGATGTGTATCGTGATAAGGACACCTGCGACTGTGACGAATTGCCTTGAGAACAACGGTAG
AACCTTTTGGTCGAGTTGCCTGTGGCTGGTATCCAGGACACGAACTTGCAACAAGGACCAGGAGGTATGGTATCCAAATGAGTTTATTATGATGGGGTGG
GCGATCGACCAAGAGTCGACACCTCGTCCAAAAGACGATATATACGAGGCTAGGCTGGCAAGAAGCGGCGCTCGCTCCCTCACCCACGAGAGACTAAGCG
ACAGCTTCCATTCGCAACAACTTAGCAAGCGATGGCAGTCTGCGTCGTCGACGTCGTCGAGTTCGAGGTGGTGGCAGCCGGCGTGACAGCAGGGGTCTCC
GTCGTGGCAGCAGGTGCCTCCGTCGTCGTGGTCGTCGGCGCCGTCGTGGCAGCAGGGGCGGCCGTCGTCGCGGCAGGCGCCTCCGTGGCTGTGGCAGCGC
TAGAGGCCGTCGACGTCGTCGTCGTCGAGGACGAAGAGCACTTGCTCGAGAAACCGCTCACCAGGTCGTACACGTTGAGCACCAGTCCGCTCGTGGGCAC
CGTCAGGTCGCAGTCAGGCGGGTTCAGCGCGGCCACCGACTCAATGAGCGACTGGCAGTTGTCCGACGCGCACATCTCCACGTACTGGGCGTCGTCCGGC
AGCGACGTCGAGTACAGCAGGCTGAAGCCAGAGTCGTCCGAGCAGCCCTGGAACGAGCTCAGCGTCAGCACGCTGGCCAGCGTCGAGTACGCGGTCGTCT
GCTCGGTCGACGAGCACGTTTCGGCGGCGACAGAGCCAACGAAGGCGGCGGCGGCAACGGCGAGGACGGTCTTGGTGTTCATGGTACCTGGTTGGCGGGT
GTGTTTGGGGAGGAGGCTAGTTGGCTGTGTGTCTGAAACAGAGCAAGTTGTAGAATGAGACGTTGCATGTCTGGTGTGGCGGCCGCTTGGTGTCCGAACT
GCAGCCGGGTCTGACGCTCACTCGGACGGCAAACTTGCACGACCCAGACCCCCCACCTGATACTGGCACGGACGTCCGATCTCTTTGAACCAGTCTGTGG
CTGGGTTTGGCTGGCTGAAGCGGACGCGAGGCGTATCTTTGGAGGACGACTGGTGTTGCACATCTGTCAGAAGGTGGGACTCATGAGCGTTGCACACGCT
CGAGCGGATACACTGCCCAATCTACTGGATTTGCCATACCCAAACAACGCTAGTTTGGGTGTCGATGTGCAGAGCATGGGCGGATCACTTCAACCAGGCG
TAGTTTGGGCTCCTTCACAGTGTCCTCAATGAAACTGCGGATCTGAGATCAGATATCCATAGGGTTGCCACCACTGCTGACGCAGACTTTTGGAGAAAAT
CTGCCACAGCAAAAGTCTGTTGCTGTGGCCGATGGGCAGCCTTGTTAATGTAATCCGCTACCTGTAGGTGTACAGGCAGCGGATTTCGGCTGCAAGGTTT
TTACAATGTTCAGCGGCGAAGCTTTTGGATTGCAGCGCTACTTATGTAAATTACGCTGCCCTCATTACACAGCCTATCAGACCAGGTCTAGCGTCGTCAG
ATTCGAGAATGGCCCAAGCGAAACTGCGCTTGGGACACGCGCTGACCTGGATCCCCGTGTCACGGTGAGTCCTAATGTAGCGCTTCAAGCCGCTTTGATT
GGCGTCGTGCTCTACACTGGCGGGCGAGACCAGCAAACTTTCTTTCATATCTCTGGCGTTCTTCCACAATCCTGGATCGAAAGTAGCAGGCAAGGCAAAG
GTCTTGCACAATAGTGTGCGCAGACACCAATGCATCCCGGCATAGTTAGATATTAAAAAAGACAGGTCGCAATGGATGAATGAAGTCGTGCTCGCGGCGT
TAACTAAGTGTACAGTGTCCCAACAAACTTTGGGAAGCTAGTTGCTGCCAGCAACACGCCAGGCAGCTTCAGCTGCCTGTCCGACGCATCGCCGCAGACT
GCCCTACCACAATCCGGACAGATCCTTCCTGTTCGAAGCCTTTGACCTCAGTTCGGACACCGAGCTTGACGCCGCCACACCGGACATGCAACGTCTCATT
CTACAACTTGCTCTGTTTCAGACACACAGCCAACTAGCCTCCTCCCCAAACACACCCGCCAACCAGGTACCATGAACACCAAGACCGTCCTCGCCGTTGC
CGCCGCCGCCTTCGTTGGCTCTGTCGCCGCCGAAACGTGCTCGTCGACCGAGCAGACGACCGCGTACTCGACGCTGGCCAGCGTGCTGACGCTGAGCTCG
TTCCAGGGCTGCTCGGACGACTCTGGCTTCAGCCTGCTGTACTCGACGTCGCTGCCGGACGACGCCCAGTACGTGGAGATGTGCGCGTCGGACAACTGCC
AGTCGCTCATTGAGTCGGTGGCCGCGCTGAACCCGCCTGACTGCGACCTGACGGTGCCCACGAGCGGACTGGTGCTCAACGTGTACGACCTGGTGAGCGG
TTTCTCGGGCAAGTGCTCTTCGTCCTCGACGACGACGACGACGACGTCGACGGCCTCTAGCGCTGCCACGGCCACGGAGGCGCCTGCCGCGACGACGGCC
GCCCCTGCTGCCACGACGGCGCCGACGACCACGACGACCACGACGACGGAGGCACCTGCTGCCACGACGGAGACCCCTGCTGTCACGCCGGCTGCCACCA
CCTCGAACTCGACGACGTCGACGACGCAGACTGCCATCGCTTGCTAATCATCATCATCTTTGCATTCTGTGCTGAGTGGTGAATGCAGAGGTAGATATGG
TAAATAAGAAACGTCTCATTATTGTTTTTTGTTGCTCGGCTTGATGTCGTGTGTTTCAAAAACGAATAGCACACGAAAAACCAAGCGTGGTAGCATGAAT
CCTGTGTACAGTGGCGGCTTCGTGTTGCATAGGAACTTCCTATACGTACTATTAGGAAGTACAGTACTAATAGTGTCTTCATTGCATCTGTGCAAGACTA
CACGTATCTACAGCTGCTGCAGGATGTAGCTATTGCATGTGCATCGCGCTCTCAGCGATGCAAACCTTGGCAGCAAATGAGGTGAAGCCTTCACTGTTTT
GGTGACGAAGTACTCGCTGCAGGATGCAGGGCGTTTGCAGTGGATTCTCTCACATCTGCATGATGTAGCATGGGCGTGCCGACGCCGCCGTCCGCTATTG
GTATCAGCAGTCTACGGTGACACTCCGCTGACGTTGAGGCTCGTTACTCACCTGCAGACGCGTGCGGGATCTGCTTTGGGACACGTGAAGCGGATACACC
TGCCCGGCTCTGCCTGCAACTCCAGGATTCACTTTTCACCGCACGGGCCTGTAACTTGGAGGCTGCAACACGCGGGATCACTCGGAGCTGCAAAGCCGGA
ACGCGTAAGCCTGCAAATTACCAGCAAGTGGTGCTTTCAACCGCTTATGTCGACCACAACCAGAGGTTTTTACCTCCTCTTTCGGTTCTGCCGCCATGAC
GAGGTTGATCTCCTTTCCCTTTCCTTGTCCACCGTGGCGGCGGCAGTATCGCGCTGTCCGAAAGTTCCACTCGGCCGCTGTTCGAACAGCAGCAGCCTTG
AGCCGCAGGCCTCACCTCAACCAGCTCATTCTGCAATTGGCCTTCCGCATCTCACTCCATCCTCTCCACCCCACCACAAGATGAACACGTACTTCGCTGT
CGCTGCCGCCGCCCTGGCCTTTGTGGCCTCCGTGAACGGTGAGGCCTGCTCGGCCTCCCAGCAGGCCAGCGCCTACACGTCCATGGTGAGTCTGCTGCAG
GGCACGGCCCTCAACACGTGTGCCTCGGACTCGGGCTACAACATGCTGTACGCCACGGCGCTGCCGACGGCCGAGCAGACCGCCGCCATGTGCAAGGTGG
ACGCGTGCCACGAGCTCATCAAGAACGTCCAGGCTACCAACCCGCCTGACTGCGACCTGAGCATCCCCACGAGCGGCGCCGTCATGAACGTCAAGAGCCT
GGCCGACAACTTCGAGCCTGGCTGCACGTCCTCGGCCGCCACCGAGGCCCCCGCCGCCACCGAGGCCCCCGCCGCCACCGAGGCCCCCGCCGCCACCACC
GCTGCGCCTTCCACCGAGACGACAGCCCCGGCCGCCACCACCGCTGCGCCGACTTCGGAGACGACTGCTCCGACCGCCACCACCGCTGCGCCTTCATCGG
AGACGACTGCCCCCGTTGTCACCCCGGCTGCCACCACCACCGCCCCCACCGCGTGTTAAGAGGCTTCTTAGCGCTCGGTGCCTGGCAAGCCGCTTGCTAG
GACCCAGCAACGATGCGTCGTACCGCTACCGCCGTTAATAAGAGGCACTCGTGCCCATTTGTGTTATAATCTGCTGCTGTTGCCTTTCGAGTTGACCGGT
GCTGTGTATCGACAATGGTGAGAATGTTCGAACAGCAAAAACCGATGTGTATTGGATTCACAGATCCCGGCGACCGGGAAAGCACCGCATCATGCGCTGC
CACTTCTACCAGCGCAGTATTCATGTATTGAAACCCACAAGACAAACGTGACGCGCTACATGTACAGTAGTATTATAGCAAGACCGTCCTATTTGAACTG
TAGGGAGCTGGTGAGGTTCAAGCCACCGTCCAACGTTTGCTCCGTGTTCTTGCCCTCTTCGCGTCCAAGAGCTCAAAGCTCCTCAGACCACTTACCTACT
GCGCTTCCTCCAGCATCGCACCGTCCTGGATTGGATCAGATAGGCGAGGAGCAATTCGCCTCGCACGGTTGGCTCCGTCCAGCACATCTTCATCGTACTC
GTCCCTCCTACAATAGCCACCAGGGCTTGCTTCGCTTGCAGCAACTTCTTAGCTGTCACGCTTCCACTGCATGGCAGTGAGCCGTAGCAATTCTCCAACC
TCGATGTGCGGGCCACGCAGTATTTCACTGCTCGTCTCTTGTCGCCGGTAGATCCAAGATCCCGTGAACCGATAATTGTGGTGCCACTACTTCGCACCAC
GATATCCTTTGCCTCGACGAAGCCCGAACTCGGCGTTGTTCCACTCGCTACCGCCTCCAAAGCCTATGCGGGCCTCATTTCCCTGCTGCTGCCCGGTCCC
TTGATTGCCGTAGGTCGCGCTGGCACGCGGCGGAGGGACGAAGCTGGGAGCGCCTTCAATGGGAGGCTCGTCGCTCATAAAATCATCGCGCTCCATGTTC
TGCAACACGAGACGCTTCAATTCGGACTGCTCCTTCTTTCCAGCGTTCTCCTGGCGGTGGCTGTGCTGAGCTAGTGATGACGCCTCGGGCACCACCAATT
GGCGCGCCTCCACCTTGCCCTTGTTACCACGGCGCAGCATGCGAAACACCACACCATCAGCGGACCCATTTGCATCATGGGACAACATGCCACGGGGGCC
CGCAGGGGTAAGTGAAGCCGAGCTTTTCACAACGGCTGGAATAGCCATCTTGTCCACATTTACGCGTGACGCAGGCTTGCGTGTGTCGGTAGACCCATGC
ATCATCGACTTGAACGCCTTTTCAAAATCTTCGTCCTCCTCACTCTTCTGAACGCGGTCGTGGATGACAAGGTGTTCTTCTTCGTCTTCATCGTCTTCCT
CCTCATCGTCTTCTTCTTCGTCGTCATCGTCATCCTCCTCATCGTCGTCGTCCTCTTCCTCAGCATCATCACCTCCTGCTTGATCGTCTTCATCATGCTC
ATCTTCGTCATCGTCGTCGTCGTCCGAATCGTCCTCCTCGTCTTCGAGGAATTCATCTTCATCGTCGCACGGCTGCGAGAGGGACTCCTCCGCTACAGTC
TCCAGACCATTGGTGGCCATTAGCAGCGCCGCATTCTTCTTTGATAGGCGACGCTCAGCTTCTTCCAAATCGCCACGAAGAATTTCCTGGACGGCTAGGT
CAACCTCCTCCCACGTTTCAAACTTTTTGAAATGGTCCTTCAAACTGCTGGCAAGCATCTCAAAGAGATCGAAAACAACGAAATCGGTTTCCATGGGCAC
CTCTGTCTTGGAGAATAGGTATCGCTGGAAAAAGGTCATGAATCGACCGAGCCGGGGTCTGGAGATGCCTCTCTCATTTGAACTGCCATTGTTTCCAGAC
ATGCTCGGACTTCCGCTGCCATTGCAGGTCTCGATCAAGGCACTTGCCAGACGAACGCGAAACACTTCACTCGGGCCATCCACCTCACTTGGCACGCGAG
GGTCGTACTGCATATCGGGAACCAGCAAGAATCGCTTCTTCATTTCCAACAATTGAACCGGCGATATTTTATCACTACTGTATTGCGGCAGTGTCAGTAA
GTCGTGCGAGTGATTGATCAGGAGGTACAGCGTTTCCACCACCACATTCATACTCACGAGGCCGCAGTTGTAAATCTCTCCTAAGAGTTTAACGTATCCG
AGGCTTCGTTGATGATCGCGGTAGTCATTGACTTCCAGTCCGTACCGAATATACTCCAGCACGTCGTCTACCAAAATCACCAGTATCTCATCGTGATATC
GCGACAGCCCCTTCACCACATCACAGATCCATTTCATTTGCATCACCTTGCCCTTTGTCACCTTCAGCAAGGCCTTCAGGACCATCCCGCAGGTTGTACT
CTCCTGCCATGGCAACCGACGGAGAGTCTTCACAACCTTGTTGATGTTGGAGCTGTTGAGGTCTTGGTACAGCACCTTGATCAAGAACAAGTACAGCGGG
TCGTACTGCTTCACTTGGCGCTCCACACGCTCGGGAGGCTTGCACATGTAGTACGCATTTTCCACGAGTGTCTCCAGCTGCGGGTCCAAATGCTTCGCTG
CTTTCAGCTTCATCATGACATTCAAGCAGTTCACCGTGCGTACATGTGTATGCTTCGAACAGTACAGGAATCGACCGCAGTTTTCGAGGAACGTCGTAGC
CACATGGACGTTGTGGCCCTGGAAATCCTGAAAACACTTTTGTAGGCAACGAAAGCCTGTGTTGGGCGGGCAGATCCGGAACTTCACCAACTCGGCTAGA
AAACGGATGTTCTTGATCTTGGATTCAAGACGGAACTGGTTGCGCCTTTTGATCAGGCCATGGAATTCGCCCACAAGCATGCCCACAAGCTCACCACCGA
TATCTTCCTTTAGTACGCTTTGCAACGTGGCCACTAGACGCGCGTAGTGGGATAACAGTTCCAAGTGGGTGCGTGGCACCGCATACAGCGTCTTCACCAG
ACGATTTCTCGATGCCTTGGAGTTGCGGTAGCAGAACTCCACCGCTGCCTTATCACAGCGGTCGCGATTGACCAAATCTTCCAGCGAGGCGAAGTACGCA
TCCAGTTGATGGTGGTAGCTGTTCGTTGCACCGCTCGACGAAGTTGTGGCACTATCACCTACACTGGTATCATCCCTTTCGTCCTTGCTCTTGCTCTCCT
CCTCCTCAGCGTCAGGCGCGGCAGGGTCCTTACCTGCATCTGCTTCCAGATCTTCCATTGTAGCGTCTCGGTCTCTTTTCCGTCCTCATCGGCATTGACG
TCAGCTTCCTCCTCCATCTCTGCTTCTGTCTCTTCTTCTCCTGCTGCAGCGGCTTCTTTCTTCTTCTTGAGCTCGGCAACATCAGCTTCCGTGAGTCCTA
AACAACTGCAGGCACCAACTCCAGCAGGTCGGGTAGGTCTTCGTAAAATGAGCGCGTCGCCTCATCATCGAAAGGCCCATCGCGGCTCAGCTCACGGCCG
CCACCTTCCCCGCCTTCCCACACGAGAATACCTCCACGACCTGAACCGTCGTCCTTCTCCTCCACAGGGAGCGGCGGGACGTCACGATCCAGCGCGTCTG
CCAGCGAGTTGACGCTCGTCTGCAGCTTCTCAAACAGCAGCTTGGCATTCTTGAGTTCCTGCACGTGTTCGTCCGTCACTTCTCCGCGATTGGCCTCCTC
CTTCTCGTTCCGCGCGTCCAGCTTCAAGAACGTGGCGTGCTGCGCCAAGTAAAACTTGCAGACCATATCGTACGCGTCGAGATAGCAGGCGAGACACTCG
TCCTGCACGGCCTTGGGCACCACGGGCGTCTGCGAGTCCACAAACTCCTGCAGCTCGTCCGTTCCTTCCAGCACCTTGTACATCTCCTTGAACTTCTTGG
GCTGCACGCCGAGAAAGTCGACGCCTGCCGACTTGGCGAAGCTCACAAGCAGCGGCACTTCCAGCTGCTGCGACGTGCCCGCACTGTTCACGCTCATGTT
GCCTCTGCTTTTGCTCCTGGAGCCTGGCTGCTCGCGCCTTGCGACGCGCTGGATGATGTGCGCGACCACCTGCACGTCGTCCAGGACGCCGGCCAGGCAC
AGTTCGCACAGCAGCCGCAGGATGAGGCGGCGCTTGAGCATCTTGCTCTTGTCGTCTGAGGCGTACGAGGCCTCGAAGCTGCCCACGAGCGCGCGCGCCA
TGCCCGGCGCAAAGTCCTCGTAGCGCTGGTGCAGCCGCGACGCCACCGTGACGGCGGCCGACAGGTCCGCCAGCTTGAGCGGCGCGTCGGCCAGTGCCGC
CACGCACTCGCTCACGTAGCGCGTGAGGTTGAGCTCGGCGGCGTCGCGCAGCAGCGGCTCGGCGTTGGCCTCGCTCAGCATGCGCAGCTTCTTGACGAAG
GCCGACGAGCGCTTGATGTCCGACTTGAGCTTGAGACGCGATAGCTGCTCACGCACGGCCGCCACCCTGGCCGTGCAGTTGGCGGCACGGAGCGCGTCGC
GCATGCTCTGTCGCTGGAGCTCCTGCAGCTGCGCACGGGCCTCTTCGTCGTCGTCGCGCGCCATGGGCCGGAGGTGGCTCTTTGGGTCGTCTTTCTTGGG
GAGGTGATCGGATTCGAGAGGGATGAGGTGGACCACATAATTAGAAGGTGGACACTGGAGGACGTTAAAAAGGTCTATTGTTTAAGACGAATCTAGTGTA
GATACTGTATAGCGAGTTGTTACGCGTCGGAGTCGGGCTCTTGCGGTTTCCGGCACACGCGCTTGACGAATTCGTACGACGTGACCATGAGGATGCCCGA
CGGACCCATAGCCAGTAGCCGCTGCAACAACAACAACAAGGCAAGGAGTTAGCGACTGCAACGTGCCGTTTTGTACAGGGACGTGAGCGCACCGCAGAGA
GGCCCTTCATGAGCCCCATGGGGCCATCGGTCTTTAAAATATACTTGAGGGTGTCCATGGCGCCGTACTGCGTATACACCTGCGCCTTTGTCCGCACGAT
GTCCATGGGGTTCGTCAAGATGCCGGTGATGATGCCGGCGCTCCCTCCGCTCATTCCCTGCGCCACCACTGCAACAAACCAACAACCATGAGTCAAAGTG
CCCAATCACCCACTCTCTTCTTCCTCTGCACCTTGTTTCCAGAACGGATCCGTCGGCCATTCCTTCATCAGCCGATAGTACACGGGCACGAGCAGCCCGT
AGGACCCCCACCAAATGGACGAGGACGGCGCGTACGTCGCGATGGACGGCACGTAGCCCTTGTAGAACCCGCGCAGACCCTCCGTGCGGAACACTTGCTT
GGTCACGTTCATGAAGCCTTTGGCGCGCTCGCGCGTCTTGCGCACGTCCTGCCCCTGTCCGCTGAGCATCATGCGCTGCGACACAATGTCCAGCGGCACC
ACGACCGTCTGCGAGACGAGCGACGCGCACGCGCCGCCCGCGAAGTTGGCCCACTTGTCCCCCATCTACCAATAATAACAATACATTAGCACTGCAGTGC
ACAACTGCCCAGCCCAGTGACGGCCGCGCACCGTCGTGTGGTCCCTGAAGACCTTGCGCGACTTCTCGTACACGGACATGTAGAGGTTCCCCGTGAGCAC
GTTGGCCGTACTGGCCCCGAAGCCCTTGTACAGACCGCGCGCGCCCTCCTGGCGGAAGATGGTGGCGAACGCGTTGGCCGTGCCCGAGTAGAGCGGCTTG
CGCTTGGACTGCACCTGCAGCCGCGTCTTGACCAGATTGCTCGGGTACACGGCGGCGCGCACGGCCAGGAACATGGTGGGGCCCAGCACGTAGTATTTGA
GCTTGTCGATCTCGTCCCACGAAATGTCCTCCAGCGCGTACTCGTCCTCCGACATGGTGGCCACCCCGCTCATAGCTCGGGCTGAAGCGAAGTCTGAAGT
TTGAGGCGGAACGCCGCTGCTGATTTCAGCCAATGAAAACGATTGACATGTTAAATGCCAGACATACTGAAACCAAGTCAAGGATTGATGACTACCTCTT
TATCAAAGATCAAGATGGCGGACGTGAGCGATGAGGAGCTGCTGGGCGGCTGGAAGCCCCGCATGGGGATGCTGTCCGTGGCCGAGAAGGTGGAGCAGGC
GGAGCTGCTCAAGCGCCAGGGCAACCTGCTGGTCAAACAGAGCGAGTTCAAGCGCGCATTGGCGTCGTACGCCAAGGTCTTCGCGTACATGAACGGTTTG
TCCGTGGCGGGCGACGCCATGTCCCAGTACGCGCAGGCGTCGGCCGGCATGAGCGCCACGCAGGAGCAGGGCGAGCAGATCCAGGCCGTCAAGGTGGCCG
TGTGGGCCAACATGGCCCTGTGCCACCTGAAGCGCGCGACGCCGGATAAGGCCCTGGCCACGTGCGACAAGGTGCTGGCGCTCGAGCCACAGCACAGCAA
GGCGCGCTTCCGCAAGGCACAGGCCATGGTGCAGCTGGCTCACTACGAGCGAGCGCACAAGCTGCTGAGCGAGCTGCTGGAGGACGAGCCTAAGAACGCC
GCCGTGCGCGGCGAGATGCGCGCGCTGCAGGCCAAGAAGCGCGCGTACGACGCCGAGGCCCGGGCCAAGGAGAAGAGCGCGTTCGGCAACATGTTCAAGT
AGATCAGGAAGGAGCAGGACCAATTGCAGACTCAAATGCAGATATCTCGTAGTTAGGCTGCTTGGCTGTTCTGGTCGTCTACAGTCGCAGGAGGTGCGGC
AGCACGCGACACTTGATGGCCGACATGAACTGCGCGTAGCCGTGGCCGAAGTGGTTCTCCACGCTCGGGACCACGAGGTCCGATACGTCGACGTTCACGC
AGCTAGTAGCGGCGGCGAAGGCCAGAGCTTGGCAGCCCGCGGCCGCCGGGCCGTTCGGGCCCGGCAGTTGCAGCGCCCAGAAGAGCTTGGACAGCACGCC
GTCACGCACCGAAAACACGTTCATGAACTTGCCGCCGCTCGGGTCCAGGGCACTCGTGATGTTCTCCAGCCCTTGCGCATCTGGGATGAACGCGCCGGCG
AAGCTGACGGCGTTGGCGATCAGTGGCAAGTTGTCTCCTCTCTTCTCCGCGCGTAGCTTGGCCATCTCCTGGAAGGCGCTGTAGATGACCGCACCGCCCA
GCGAGTGACCCAATAGCGAGATCTTGCGTTCCCGCAGCAGCGTCGGACGCTCGGCCAGCACATGAGCGAGCAGCACGCCCACCTGCTCCGCCTTACCCTG
CGCACTGTGCCACGGGTTGCCTGTAAAATGAGCGACCATGGACGACACGGACGAGCTACCAAGGTTATCGTTCACGTGCGCGCAGAAGTCGTTCCAAGCG
GCGGCGTCACCGGCCTCCCACTCCACGGCGAAGACCGCGGCGTCCTCGTTCTCCTGGGTCCACGCGCGCCAGTTGCGCGTGGGGTCGTCGCCCTGCGTCA
TGAAACCGTTGATGCAGAGCACCACGTGGCCACAGGTGGCTACGTCTCCGCTGAGCAGCTTGAGCTGCAGTTGCTGCACGCGGCGCTTGCGCTTGGCTAC
GTTGAGCGTCGCCATGGCGCCGTCGTACGCGCTGGCCCACAACGTCGGGGTCGTGGTCGTGGCCGTCGGCGCGGGCGCGGCCGCAGCCAGGCGTTCAAAG
CACCTAAGGCGCCGCCCACCGCTACCGCCGCAAGCTCTGCGTTACCGATAGTCTCCTGTTCCTGTTCATTCGACTGCAGCCGCACGCGCTCCACGATGGC
GTCCGCTTCTTGGACCAGCAGCGACGACACGCGCTCACGGAGGGAGTCGGCCGGACTCGTCTCGTACTCCTGAAGTTGCTCGGCCGACAGCAGGCCGCGC
CGCTGCAGCTCGCGGCTGTCGGCCAGCAGCCTGTCCAAGTCCGTCATGGATCGACTATTGTAATAGTGACACACACCACGTCTACATGTATTGGTGTATG
GAAACCCCATGTTGAAGTGGCCGGTGGTCGTTACGCCCTTTGGCGGCACACTTGGTCTCGGGCGGCCGGAGACCAATTCAGTTTGCGCCGGCCATGACGA
GCGACCTCGAGCAGTTGCCGGACCATTTGCTACTGGCGCACGTCTGCCGCTTCGTGCACCTGCAGGACCGATGGCACGGCCTGGCACGCGTGTCCAAGCG
CTGGCGACGACTTACGCTTGCGTCCGTGCATCGAGAGCAGCACGTGGACTTGGTGCGTCTCATTGGAGCCTTTTGAGATGTGCAAAGGACTAACCGGTGC
GTGTTTTGGACTGCAGACGTGGTGCACGGGAGAGCATGAGCTGGAGGCCGCGGCCGCCGTACTGCTCGACCGCCAGCCGCAACGCAGCAAAAGCGGCCGG
AACTTGTCGGTCGAGGCATCGCAGCTGCAGAGTGTGGCGCTCTACGGCCCGCGGGTCACGTCGCCGCTGCTATCGCACCTGGTCAAAGGCCTCGGCTGTG
AGCAGCTCCGGCACGTGGACGTCGAGTCCAAGCAGATCTCGGACGCGGCGCTGAAGCAGCTCTGTCGCTGCGTGGGGCTGCAGACGCTCGCGCTGCACTG
TATCAAACTCACGGACGAGTCGCTGGTGGCCATCTCACGGTCTTGCCGCCAGCTGACCAAGGTCGACCTCTCAGGCTGCTCGCGCGTGCGAGACGACGGC
ATCGTCGCCATCGCGGCCAACTGCCCCAAGCTGCAGAAGATCAACCTCACCATGTGCCGGCGCATCTCTGACAGATCCGTCGTAGCGCTGGCTCAGCATT
CATCGGCGACGTTGGAGGAGGTCGTGCTTGATCGCTGCCTCAAGGTACGCACGTCTGCAGCGTGAGCTCGTTTCGCTCGCATTGACTGATCGGCTGCTCT
CCGCTAGGTTTCTGGGCCGGCACTCCGCTTCCTCATGAGAATGCAGCGCAACCTCCGGTCCTTCTCCTTCGCGCGCTGTCCAAAGGTTCAGGGCGTTGAC
TTCTATAACCTCGAGCAAATAGCGCAAGCAAAAGCGACCATGCCGACCTGTAAGCTCGCCGCATTGGACCTGAGCGGGTGCGCAGGACTGGACGACCGCG
GTGTAGCGGCACTGATCACAATCAACCGGTACACGCTACGCTCGTTGAACCTCGGGGCGCTGCAAACGCTCGGTAGCGCCGCTTTCGCAGCCATCGCGCG
GTGTTCGGAGCTTCAGTCGCTCAACCTTTCGCTGTGTCGGACGCTGCAGAACGACAACCTTGCTGCTATCACGGCCGGGTGCACACAGCTTTCAACTCTG
CTTCTGCAGGGCTGTGTCGCTCTTGATGATGGTGGCCTCAAGGCGATGGCTCCTCGAGCGACGAATCTGCAGCGACTGTCGCTGGAATTCTGCTACAACA
TCACGGACGAGGGGCTCGCGGCCGTCGTCTCACGCTGCCAGCAACTGCTGCACCTAAACATCAAGGCTTGCAACCAGCTCACGATCGCCGCCTTCCAGAC
ATTAGTTCGTCGAAAAGCGCTACTAGAAACGCTGAACATCGGCGCCTGCGCCGATATGGAGACCACCGCCGCGTACTTCTCCATCGTCAAGCACAAGTTC
CCTCGGTGTCGAATCCACTGGGTCTGAGCTGACGACCAGCGTCCTAGAGGCTCTGTGTAGAGTAACAAATATGCATATTTACCTTATCCCTGGTGCAATG
CGCGACTCTGATAAGACGAGATGGCCGTCGCTATAAGCGGCCAGCCCGTGAGGAGGTTCACCCCGGCATAAATTTAACGAATTTGTAGCGATGACTTGCT
TGCCTTGCGTCTTTCATCTTTATTTATCTGGACGTGCATGGGCGTTTTGTCCTGCCACTTGAGAAACGAGCGTGGGCCGAGTGCAAGAAAGCTCAAGCGT
GAAGTCATCGTCCTCTGCTGTGGAAAACGATGTCGGGCCGCATTCCTAACGTCAGCACTCGGATTGTGCCCAAGAGCATCACACTGCCCGAGACAGGAAG
CTGCTTCGACACTACCACCGTGGTCCCGAAGGTAGGAGCTCAGTGGACATCGCCCGGAGACGATGTCGACACTGATGGTAGATTTATTCATGAACAGCGA
CGCTCGAACGAGAAAGTTGACGACTCGGCGCACATCAGCGCGTTCTCGCTGTCCAAACCGACCAAGCCGCACACCACCGACGGCTTCCTTCGAAAGGGCC
AAGGCACAGGAGGCTCAATAGACTTGGAGAAAACACTCAAGGTCTGTGGGGATTGCTCGAGCCAACAGTGGCGAGGAAATACGCTCACACCGTTTGATTC
TAGGTTGACAAGTACGAGAATGTGTCTCCGCGCTCGCGGCACCAGCAGCCTGCAGCATTCCGAGAGCGCGCTAACCCGCCCGATACGTCTTTCCGAAGGT
GAAGCGATAGAAGGGATTTCATGGTTGTGCTTCAGAGTGCTCACGTTGTGGTGAAATTGCAGATTTTATGAGCGTAGCGACCTGCCGATCCAGATTGACC
ACGGCGGCGTGCGCAACATGGTAGCCTGGAAAGTGGACATCACCAAGGTATGCGGTACAAACTCAGCGTCCTGGACTCGCGTTCTAACCGAATCTGTGGG
TTTCTGTAGCTCGACTTCCACCACTACCTCCCGATTTTCTTTGACGGACTCCGAGAAGTGGAGGAGCCGTATGCATTCCTATCGGAACAGGGCATCAAGG
ACATGCTCATCAACGCCAGCAACAAAGTGCTGCCTGTCATCCCGCAGCTTATTATCCCGATCAAGAGTGCGTATTTTCAGACAGTTCTCAAAATTCGGCT
TGGCCTGACGTTCTCGTTGTGCTAGACGCTCTCAACACACGAAATGCTGGCATCCTGGTCAAGACGCTGCGCATTCTGCAGCTCATGGTGACGTGCGAGT
CGGCTGCACAGCCAGGCACTGGCCCGGGACTAATCGGCCAGGCACTTGTGCCATACTACCGGCAGATTCTACCCGTCCTCAACATTTTTATTCGCAAGAA
TGGTACGCAAAACGATTTTCTGCGAGGTGTTGCTAGTGACTAAGCTTTGCACACGCTTCGGTTTCTGCTACAGACAACATCGGTGACGCCATTGACTACG
GTCAGCGCAAGCAGTTGAATCTCGGCGACCTTATCCAGCAAACACTCGAGATCATGGAGTCTCACGGAGGAGATGACGCTTTCATCAACATCAAGTACCT
CGTCCCCACCTACCAGAGCGTGTGCGTGGGCTAGCCTCGCAACGCCGAGCGTATCCCAGCTAGCAAGACGAGAAAAGCGTACAAGGTAGATAGCGAGCAG
CAGTCTTTGAAATTCGAGGCCCCAGCAAGAGTAAAGCAACCAAACTTTTTCTGGTCACTTGTTATTCGTCATGTTTGGTTCTTCTTACTGCTTTGGCACA
CCGTTGTTTGTTACAGCAACATATTTCTTCTTGTACCGCCTACTGCTGCTGACTTGGGGCGTGGTTTCACTCGAGGAGGAGGATCTCGGCGGCCAGTCAA
GGACTGTGCATTGCTACTGCTTGTGCCTCGGCTAGTGACAGGCGCTGCCATCTTCGAGGGCATTGGTGCTCGTCCGTCGACTTCAGTCGGAACTTCATCA
GTCTCGGGAACTTCTGCGGTCAAAGTGGACTTTGCTTCCGTCCGACTCGAGAAAGCACCCGTGCAGTTCCACCGCCGCCCTTCACCCCAAGCTCCTCGTA
TCGCCTCAGTCTACGCTCCAGCTCCTTGTTCGCTTTCCGATACGCGTTCAGCTCCGTCACCAGCGAAGAATTTTGATACGACAGCGCTGCAGCGAGTTTG
TGTTTCTCTCGGTTACCAGCTTCCACTTGGCGCCGCAGCGAGTGCTTGTTCTGTAGCAAGAAGCGGTTTTGACGATGCAGTTCAGCATTGACCTCGCCGG
CTGAGTCTCCGCGAGCTTGCAGGGCGTCCAGTTGCCGCGTCAGGCGCTTATGAAGACAACCGATCTCCGTGACGAGAGTGCTCTTCTCCTGCAAGGCACT
GCGTCGAACGAGCTCGCCCAGTTCTTCTTGTAGCACCACAATCGAGTGTCGGACTCGCTCCAACCGCTTGAGGGCTGCCTCCAGGTCGCGCGCGTGCTTT
CTTGCAAGCGAAGACGTCTCAACTCGCAGTCGATCGCTGATGTTTGCCTGCACCACAACCTCTTGGTTGGCGTCATGCAGCTGGTTGAGGTGCTCTTGCA
TGTGTACCAGCTCGCGGTCCTTGGGGAGTATGTGCTTCTGCAGCAGCTCCAGCTGTGAGCGGTGTACGCCATCCAGACGCTGCAAATTCTCCAACACGCG
TCGCTGCTCAGCGAGTTGGGCTGCACCTTCCTCTTTCTCTCGCATGATTCTCTTCGTAAGAGCTCTCTCGTCCGCCAGCTTGCCACGGAGAGCTTCCATC
TCATGCAAGCGTTCGTCGTAGTCGCAGCACATTTGCTGCAGCTCGCTGTCCTTGTGGTTGAGGTCTCCAAGCAGCATCTTGACCTCTTGCTTCAATGCTG
CCGCCTTCCCATGCTGCTCGGCGAGCTGCGTTGCGCCCTTCTTCTTTTCGAGATCGATGGAGCTAGCTAGCTGGCCCATTTGTACCAGTTGGTCCTGGTC
TTGCTGGCTGAGCACTTCCTGCAGCTTCCTCCGAGTCGCCTCCAGCTCGTCGACCAACTTGTTTTGTGAACTGTCAAACTGGACTTTGGCCTCTCGAAGC
TTCTTCCTGCCTTCGTACTCCAGCTGCGTTTCACGCTCTTGCGCTCGCTTCTGCTCGTCCTCCAGGTCAAGCTGCGTAGCGTGAAGCTGTTCACGCAGCG
TGTCACATTCAGCTTGCAGTTTTTCCAGAGTTACCAGGTAGTGATCTTGAGCCGAACGAGCGTCTTCCGACAGCGAACGCAGCTTTGCTTCTCGGTCGTG
GATAGCTCCGCCAAGACGAGCGTCGAGAGCCGTACATAGCGTTTTCTGTTCCTCTTCAGCCGTCCGAGCGTGGGCTTCAAGCTGGCTTTGCAATGTACTT
TGGAATCGTGTCCGCTGGTCACTCGCTTGCCGGCTCAGCATCTCGTTCTCCATCTTAAACTGCTGCAGCTCGCCATCCAGATCCAACAACTTGAGTCGAG
CCAGCTCTACCTTGCTGCGGTCGTACACTGCTAACTCCTCTGGCTGGCAAATGCTCGTGAAGGCATTAACGGACAAGTCGTGGAGGTGTTGGTCGTCTCG
AATTGCTGTCGCTAAGGCTGAGGCGCTCTCGGCAGCTCCAGAATTCTCTCGACAAAGCTTGCAGGCTAGGACAACGCCGTTCTGAGCGTTGGTGAGTAGC
AATCGCGACCGAGCAGTGTAGAACAAACCTACTACCGGTGCCGTGTGCAGGTCTACACGCCTAATCGCGTGTGTGAGCAGGATGGCCGACCGACTCCGAG
CTCCTCGCTTCCAACTGAAGAGCACCACCGAACCACTCGCTGTGCCGACAAACAACAGGTTCGAGTACATGTTGCCATCGTTGCCTCCCAGTCCTCGTCC
TGCCTCGAGCGCCGTGATCTCAAACGCCAAATTCTCGCCCACACCGCCGCCAGTGGAACTATGAAGCGCGTCGGAGGTTAATTCGCCATTCACCCATGCA
CGCACAAGGCACTGGCTGCTGCTCGCTCGCTTGTGAGAGCCTGACACCCGCTTCTCGCTACAAACACTGCGTAGTCGTGACTTTCGTGGTCCATGTAGCT
GGTAGTAAATGCCACGATGGCGTTGTCCGGCGCAAGTGTCTGCGCCACGCTGTGTGTCCCCACAAGGTCTTCGACTTCGCCCCCGGCTTGCCAGCGTAGT
TGGCAGTGGCGAAGTTCTCCGGCAGCATCGACGGCGAAGAAGCTGCTGTCATGAACAGACCAGCGGAACAGCTCGACGGTGTCGCAGAAGTCTCGAAAGA
CGCCAACGAGCTGCGGCTCTCGCTGGACCCGAGACAAACCTCGATACACGAACACTGCTTTGTTAGTGGCGTGTACAGCTGCAAAGAACGCGCCGCTGGG
ACTGTATTGAGCCAGTGAGAGCTGCTTCTGCGGCATCTCGAAGGCCAAACGCAGCGAGTTTTGCAGCACGAAGAAGACCTGAAGCTTGGACGCGAACGTC
ACCAACAATTCGGAGCCTGCGGGGTGAAGATCAAGGCTCAGCGGCGCTTGTTGCTCTAGAAGGTGAACCACAAGGCACTCGTGGCAGTCGGTTTGGCTCC
ACACGTGGACGGCTGCGTCTCCGTCCGGGGACCGACAGGCTGCAGCGAAACACGGACGTCTCGACGCTGAACTCAGTCGCTCCATTTGCTGGGATAACGG
CGTGGACGCCAAGACACTCACGCAATTGTTTCATCGTCGCCGCGGAGAAGGCACAAATTGCTGAGGTCGTAGGCCCCGTAGCCCTTTTCAGTACAACAAA
GCAGCATGGCGGCGGCGGGGTCTGTTGTCACGCTTACGATACGCTCGCTACGAGTACAAGAAGCGGTCGAACGTCAGTACCCCGAGCGAAATCAACTCGT
TAACCTGCACCCACGTACGTGTTTGGCACTCGCATGCGTCGCTGGAGATGCAGCTCCTTCTCGTTCGCCTTGAGCATTTTGGATGCCACACGAACGACGG
ACACGAGTCCGTGAGTGCCTCCGACGACAACTCCCTCGCCGTTGTTCAAAGCGCTCATGCACAACAACCGCCCCAAGCCTTTGTGTACTGCACGGAGCGT
CTGGATCAACTCGGCATTCACCACCAACTGCACGTCGCCGTCTTCCAGCAGACCAACCAGCACGTCGTCGGGCAGCCACGCGTGATCCGCGTAGCTCACG
ACGCTTTTGACTTTGGTCTCGTCGCCCGACTTGAAGCTCGCCAGCGGCTTGAGCGTGTACTCGCACAGCGTCCAGAGTCGCAGCATATTGCCGCCGCTCG
TAGACAACTGAGCCATATCGATGGGGTTGAAGCGGACTCGGGACACCCGGCAATGGACATCGGTAAGAGCTACTTGCCTGCCACGACCCCAATCCCACAC
GCCCAAGCTCCAGCTCGCGTTCGCAGCCTGACCGCTGACCAATTTCCCATCAGGAGACAAAGCTGTTCCTACGAACCGATCCGTCCAGGGCACGGTGAGA
GTCTTGAGCAGGACAATGCGTCGACCTTTGCCTGCAGCTGGGTCAGGTTTGTCTGTTCTTGTTGCAACGCTGTAGACAGCGATGGAGGCTGGCGAACTGG
TACTCTCTGCATTGCCATCGTCGGCTTTCACTGCAGCGCGACAAACCGAAAGGTGCTGGCGTTTCCCGCACAGCGCCATCGCTGTAATCTCTCCAAGGAA
CCCGACGATTGTCCTTGGTCCGTCACGAAGCTCAGGTCCTGTGTCTGCGTGTTCTGGAGCACGACGTACTTGCCGATGGCCAGCACAAGCTCCTGACGAC
TCAGAGGCAGAATGACGTCTCGGAAGGACGTGTCCAGCCCATTCCCATTCACCGGCACCAGCGTCGGTGGAGATGGAGACGCACTCGACAGAGCCTCACG
CATGTTCGATAGCAATGGACACGCT