Description :
From Genome Similarity Track
Location :
scaffold_168:43893- 44953
Transcript NameFunction/comments
g4980.t1 hypothetical protein PHYSODRAFT_320443

Sequence
1060 bases(100 bases per row)
CTTCTCGTAGTTCCTCATGTAGCGATGCTAAGAGCTGCTTACTCGTAGTGTTCACCAGCTCCAATGCACTGACTTGTTCCTGCAACTGCTTTAATTGCTG
GTCATGGCACGATAATTCTACCAGCAGCTCATCTCGGTACTGATTCAGGTCGGTGTTAGCATCTTGCAGTCTCTCTTGTAGTGACCGAGTAGGTGGCGCT
GATGAATCCGTGCCAGCTTGAGGCATCAATACTGCAGTCGATGTACTTGGCTGTAAATCCACTGAAGGCTCTACGATGGGTAGGCTTTCTTCTGCTGGTT
GGGCCATGGCGACACGTGAGTTGGCGACCTCAAGCGTGGCCTTCAGATCTTTCACCTGCTGGGCTTTAGCTGCATGGGCAGCCCGAAGTGCAGCAAGGAC
AACCTCAACTGCTCGATGAGCCCTCTGCGCGTCGACGAGCCGATCATGGAGTTCATCTACTTGAGTCTGTGTATCTCGGTGTTCCTCTTGCAGTTCTTGC
CACTGAAGGGCTAACATTTCCTTCTCATGTCGAAGCTGATTCACTTGCTCGCGGCTTTCTTCAGCAGCAGCGGTCTGTTTGGCGAGCTGCGCCTGGAGAT
CTATCAGCGATTGCTCAAGCTCCTCTTGGTGACGCTGCAATTGTACCTGCTCATTTTTTACCGCTCCCAGTTCGGCTTGTGTAGTCACTGACGCCCGCTT
GTGCCTCAAAAGTAGTTTGTTGACTGCAACCATATCATCGCGTTCGCGCTGCACTTTGCGAGTCTCCTGCAACAATGCTTCTAGCTGACGAGCAGCTACG
TCCTGCTCCTTTTTTATAGCGTCTTCTCGTTCGCGCTGCAACGCACATAGCTGCTCTCTCACAGAGCTTAGCTGCTGGCTCACTTCAAGATACTCGGTCT
TCAAGTTATTCACCAATACATCCGAACCATCGGCATCTTGTCCTGTTGTCTCGGGAAGCTGTAGGCAGTCAGTTTTTACTTCGAGGCCAGATTGACTATT
GCGACGTGAACTCGGCTTTCCCGGGCCCATTGATAGGCTGCTCCTACGTCGTGTCTGCCG