Description :
From Genome Similarity Track
Location :
Scaffold_15:438868- 445488
Sequence
6620 bases(100 bases per row)
TTCGGGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTGTGCAGCGCATGGTGGGCTTCGTACGCCCTCATTATGTCCGGGACGTCTTCGAGCA
AGACGTTCCGCGGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACTGGTTGCCTGTTCGTTCTCGGGATACTGTGATC
AACAATCCGCTCAACAATCCATCGAGTTGAGCCGTGTGCATCACGAATCGGCGGCGGCGGTGGCGGGAACACGCCCCGTGTGTGGTCAACTTGGTGTTGA
CCCTGATCTCGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCCAGAGCGCTGGGTTCGGCGCTCTGAAGCATCCTCAGGTTGCGGCGGCCTCC
CAGGCTGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGAAGTCGCGCTGGAGAGGATGACGGCTTCCGCCGAGTCTT
CTGTGGTTCAGCCGAGCTAGGTAGCTCGTGCTGCAAGTATGGCTTCAGCCGTCCGACGTAGAACGTCGGATGGAGGCGCATACTAGACGGTATGTCCAGT
GTGTAGGCATTGCCGTTCCGTGCCAGCACAGTGAACGGTCCGATGAAGCGTGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGT
TTTGAGTAGCTAACAAGACTAATGAACCGTTCTCGAATCCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGC
AATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCCAGCAGTAGGCCCG
GCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGTCAGTGTCTGTGCCCC
GCACAGACACGTTCTTCGTGCGCTTGTCGGCGTCTGTGCCCTGCATAGACGCGCGGTTCTTGGCTTTACTTCGTGTCGTTGCGGCTGACACTGTGCAAGT
GTCAACGGCATTCTGCGGCTGCTGCGGTGCAGTCGGAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGACGTGGGTGCCTC
ATGGCATTCACGTAGAAGGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCATGCACTCGCTCCAGTGTTGGAACG
AGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCATGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACT
CCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGCGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTAAACACCATG
TCGACGAACAGACGTGCAGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCG
TGTTCCCCTGACTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACGTGGACTGCCAACACTCTCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGC
GAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGATGTACTCGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGA
AGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTACATGATCCTGAGTCGCAGGTCAT
GGTCATTGGGCACGACAGCGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGTAACGGTGTGCACGAGCACGAAGATA
CTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCTCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCC
AACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGTGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCA
CCACATTGAGCCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCGTTCGTTGCGAGATGTGCGGCGACTTCAC
AGCCGTCCGCAGCGACGCGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGC
TCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCCGGCGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACG
CACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCCTCTTGAC
TGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCGTGTCCGCATAGTCCTTCACG
TACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAG
GGCGGACACCGTTCTTCCCAACGATACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTTGCATAGAGCTTTTGCTTGCACAT
GAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGT
ACGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGAGTTCTTCAGACCCTGTGGCATCACTAGCCACTCCCAGAGCA
TGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCT
CCTGGCCATCGAATCGATGATAACATCTTTTTGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAG
CCGCCCTGTGGCTTCTTGACACATATCGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAGAAGTCGTCGA
TCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCCTGCGG
AAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTTTGCTCTTCAAAG
CGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGCGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGG
CGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGTGAAGTCAGCTCCGACGCTTG
CGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCAGCTTCTCAGCCTCCGTC
TGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGC
TTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTG
GTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCAGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCT
CCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCAT
CCAAGCCATCGACTCCCGTAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGA
GGCGTGTGACTCGCCTGCGTCATCCGTTCCCCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCCT
TCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGTGGCATTAGGCGCTGTCTCGA
GTGGGGAGTCGCGCGCACCTGTCGGTGCGTGGGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTC
CCAATCGATGACCGGATCATGCCGTGCAAGCCACAGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCGCGACAAACTCT
TGATCTTCATACGTGAAGCGCACGCGTACTATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACCTCCAGCATACTTCGAGGTATCTTTA
AATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGAGGCGCCCGAATCAACCAAAGCACGAACAGATTTCCTCTCTCTCTTCGA
AGACAAGTTCAAGATGACAAGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAAGGGTCCTCACTGGGGGCTGCAGTCCTCAGTGTCGCATGTCCGAGT
TGGACATGCGTGACTGCTTCACCAGTAGGGTGCCCCGCGCCTATTGGGTTCCAGCGTTTTTTGTTCGTTCGCGACGATGCCCGGCATCGCCGCGTCGACC
ACCATCTCGGTGCACGGGTGCCGTGCACTCTCGGGCATAGTGACCGATCCTTCTGCAACGGAAGCATCGTATATTACTTCCTTGTTGCTGTTGATAACCA
ACAGCCGTTGCATTCGAGAGGTCCATTGGCTCCGGACCTCCCGTCCTCACTATGGGGCGAGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCC
GCAGGCTAAACTCCTCCTGCATTACAAGAGTGATTGCAGCTTCGATAGTACTCGGGTACTCACGGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGACC
CTTCATGAACGTGACGACCTTGGTCGCCTCGTGTATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCTCTCTGCGCGTACGCATGGAAATCGTGC
TTACCCTGCTGTAGGTCGAGGAACTCTGCCCTCGACCCAAACTCATTTTGCGGGGGCTCAAACGCTTGCCTGAGCTCCTCCTTGAAACCCTCGTACGTGC
TGAAGCACGTAGGATCAGAGAGTCGGCGTCCATACGCCCAACGTCTCGCTCGTCCGCCAAGGCATGACATGGCGAACGCAACCTTGGACAACGGGTCGAC
GATACGTCGAGCCGCGATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCGACATAGTTGCTCACGTTTAGCTTCAACGTT
TGCTCGCGCGGTGTCGTCCCCGACGCCACCGTGATAGAGGAAGCAGCATCACGCTGTTCCTTCATGATGAATCCCAGAGCAACACCATGTTGCTCCGTCG
GCGATAGTGTGCGCAGCATTGCAGCTACAGCCGCTTCACCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCATTCTGGATCCGACAGGTGGAGGCAGTC
AGCGCGTGCAACATGAGTTGCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGTGCTCATGAAAAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGA
ACGTTCAGGTAGTCGGTCGTTGGACGGACTACGAAGTGCTACCAGGTGTAATGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTA
TGAGGAAGCGTAAGTTTCTTTTACTTGAGTTAAGTATACTCGATATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTATCGGGTTTTGGTAAAA
GATGAGAACTGCTATTTTTGTTTTATGTTTCTGAATTCCTCTAAATGTAATATTCTAAACTAGGAATCTGCCAACGGCTGGAGGGCAGAATTCCAATGCT
ATGCATGTCACTCATTGGCTAAAAGATGCTGCTCTCAACCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGATCCTAAATGTATGTAGCCT
TTGGTGTGTCTACACCAAGG