Description :
From Genome Similarity Track
Location :
Scaffold_104:43881- 45588
Sequence
1707 bases(100 bases per row)
GTCGCGAAGTTGTCCACAGTCGCAGTGTTGTGTTTTTGGAGCCACCAAGTTCTCCTTCGTCGACAAGTATAACAAACCCGCGCGATGATCCTCTTCAGAT
TGTTGAAGACAGCACTGAAGAAAGTGACGACGAACCTACTTTTGGTGACGAAAATGATGTGACAACCTCTACTATACAGCCCTCGTCTTCAACTCAGCCG
AGTGAATATACTGACAATTCAGCACCATTTGAACCCCGTCGTTCTCGCCGAATTGTCAACCTACCAACCAGTGTGGCATTAAGTGCTGTGCAGGTTCATT
TGCGGGAAATCATCCAAGAACCTGTGAATCATAAAGCTGCCAGAGCATCCACCGAGTGGCATTTGTGGGAAAAAGCTATTCGTGACGAAATTGACGCACT
GAAAGCGAACGACACCGTCGACTTGGTTGACCCACCACCTGGTGTCCATATCATTGGATCTACAATCGTTTTTCGCGTGAAGCTAACTGCACACGGGGAA
GTCGAGCGCCTGAAAGCTCGAATATGTGCACAGGGCTTTACGCAAGAGTTCTTGAAAGACTACTACGAAACGTACGCTCCCGTGGCGAAATTAACCTCCA
TCCGTGTTTTCCTTGCAATGGCGACCCAAACGGGCATGCGCGTACGCCAGGGTgatgtccccacggcgtacgtcaaggctgggctgactgaagtactcta
tgtacgacagccacacggattcgaagaggggagtcgaaccaaagtttggcgactcaagaaagccctttacggcctaaaacaggcTGGGCGGGAGTGGAAC
GTGGAGTTAAACAAGTTTCTCGTTGCTTATGGACCTATTCCTACTCGCGAAGATGCCTGTGTTTACAATCACCCTACTAACGAATTGATCGTGTTGATTT
ATGTAGATGATATTCTAATCGGCTACAAAGATGAACAATCAATGATGAACTTCATGCAAGCGTTGCAAGCCAAGTATGGAGTTAAAGACCTGGGTGACGT
GCAATGGTTTCTCGGAATTCGCATCTCACTGGACGTTGCTCGCGGAATTACCACGCTGGATCAAACGCAATATGCCTCGGAAGTGCTGTGTCGTTTCGAG
ATGGAGGAGTGTCGACCCCGAAAACTTCCGCTTGACAAAGGAACCATATTGTACAGCCGTGCACCACACCaagaagccgcagatcaaggcacttatcgac
aagcagtaggtgctctcctctacttagctagtgtgacacgtccagatattgcatttgctgtcaatcaagtcgctgcgcatgcatcaaacccttcgaagga
gcactgggttgcggtgaaaaacattttgcgctacgttgaaggaacgaaagcctggggacttgtgtatcgccgcagtgaaaacgcagcccctgttcgagta
tacacggatgcagactgggccaataatgaggaggatcgaaaatctgtctcgggtgtccttgtccaagttttcgggtgtcctgtatcgtggcaaaccaaac
gacaacgaattgtctcgaagtcaccaacaattgccgaatacattgccgctgatgacggcattgaggaagctcactgggtgcTTTTGCTTCTTCAAAGACT
ATCGAAAACAACAATTGAAGTACCTATCCCTGTCATGATTGACAACAAGTCTACAATCAAGCGTTTGGTGAATGGCAAGAATTCCGAAGCTCAGAAGACT
GTTGACT