Description :
From Genome Similarity Track
Location :
Scaffold_1:4387675- 4391113
Sequence
3438 bases(100 bases per row)
ATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCTAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATT
TAGAAGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTAACCCGAAAACATTATTTGGATCGTTTATTTAAATTAATCTATACTCGGAGGTCCG
AGTATAATTAACTCTAGTTTAAACCAAGCTACGCTTCCTCGAACACGTGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACACCTGG
TAGCACATTGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTATGTTACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTACCCATG
GAAGGCCCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAGTGAGGCAGCTGTAGCTACG
ATGCTGCGTACGCTAACGCCGACAGAGCAACACGATGTTGCTCTGGGTTTCATCCTGAATGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCG
GGACGACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGC
CATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCTACTC
TCGGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGGCAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGTGGAGTTTC
TCGACCTGCAGCAAGGCAAGCATGACGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAAGCCAATCGACGAGGCGACCAA
GGTCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAAATACTCTTGCAATG
CAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGTCGAGGCCACAGCCACGCCCGGTAGGGAGGGCGGGAGGCCCAGAACCCATGGTCC
TCTCGAGTGCTGCAACTGCTAGACCCCAGCAGTCACAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCGCTATGCTCGGGAGTGCACGGC
CCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCAACGTCGCAACCAAAGAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTA
ATGAAGTTCCGCGTGTCGACCGTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGATTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCT
TGTCATCCCGAAGGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCGGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCA
AGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATAGTACGCGTGC
GCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGAATATGGACGATAAGCTTGACATCGTATTGGGCATGCCGTGGCTTGCACGGCA
TGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGATAGCGGAACAGTGTGCGATGGCCCTGTTGCCGCTACGCACGCACCGACA
GGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGT
TGCCGCCGACAGCTAATGAAGGAAATGTGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGTCTCAAGGAGCACGGATGA
CGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTTGACT
CCGGGAGTCGATGGCTTGGGTGAAATTGATTCCTCGGCTCGGGGAGCCGACGTATCCTCCGTAATGGGGGTCTCCGCCAACGGTTGGCGTCGAGGTATTG
AAGTCGCATCGACTCCGGGAGTCGACAGCTTGGACGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAG
GCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGT
GCAGACGGAGGCTGAGAAATCGGACGTCGAGACGTTGAACGTCTTGACGCGTAACTGTGCCGGGTTCCTGTACAGGGAGATGACTCTCGCTAACCCTCCG
ACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGG
ACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGA
GCGCTTTGAAGAGCAGAGCTGGGACTCGTAGAAGACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTTCGGAAGAGATTCCTGCGGAG
CTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAAG
CGATCGACAACTTCTTCGAAAGTCGTCGCAAAGCTGGGCAAGTGCGGGAATCGAAATCCCTGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGG
CGGCTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGGCC
AGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAAATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGAGCG
GCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTT
CGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCC