Description :
From Genome Similarity Track
Location :
Scaffold_266:43873- 46575
Sequence
2702 bases(100 bases per row)
GAGGAATAATAAGCAAGTGCTTGACACTTAGGGGCAGCAAAAATCGTGCACTTTCGGCAAACTGTAACTGTGTAGTGTTTTCATTTGTCGTACTCGATAA
GTTGAAAAGTGATAAATTATGGTCAATTTTCTTTGTCGGTGGCAGAGGGAGTTCCCTCAGTTTAACTTATATTGCTCATTGATCAATTATATGTCGTCGG
CCGCACTTTGCGGTGATGCCGCAAACGGGAAGGATCATCCTCCGTCTCTCTCCATAGCGTGCTCTCCTATCATATTATATGGGTGCAATTTTCTATCGCT
AATTGTAAATTGCTAAGCAAAAATCATTGATTTGACAATCTAAATTTGGCTAGTGAAAATGTTTTACATCGTGTGCATACTTATTGGAACATGGTAGTTA
TACTGATCGAATGAGTGAATCTAACAATTTCCTTATAGAAACAATCATTCTTGTTCTACATAAGTGAGTTTAATGACGGAGCAAGTCGTTATGTGCATGT
TCTACGTCTTTGTGCACATCATATCGAAAATTTTGTGTGGAACGCGAGAGCTCTCATCTTAAGCGGCATGAGTAGCCCAATTAAATCGGGTAGCTACAAT
GAATATGCATCGTTCCTCTAACGATACATATTTATTGGATTCTACTTTACCGATCTTAAACCTTACATGTAAGTCTAGTTGATAAAATGCTGTTACATGT
AGTGTTATATAAGCAAAAATCCATCCTCTTTTCGGTAGGGTTTGAAGATTGCTTACTGTTGCGAGTTATACAGATCAGTCGCCGGACGTCCAATAGACTT
TTGATACCTACACTATCGCCATAGGAAATTCTGACGTCTAAAACTGTACTGCGTGAACCTGTGCGAACGCAAAATAGTTGGACTCGACAGAATCATCCGT
ACGCTTTGTTTGATTACAATAGGTGAGTTTTAAACTGAAGTACCTGTCTCTATCTAAGTACTAGACGAATTATAAAATGGTCTCCAGAACCACATAGTAT
ATGATTAGTCTTCGCCGCTCACGTGCGTAATCACGATAAAACCAGTCCAACTCATTTTCCAGGATGCTGCATTCTATTCTCAATATGGTGTTGCTGTTTG
ACACTAAGATATCTGAATAGACAAAAGCGAGTGCGCTCATGTTCGAATCGCTATTCACAAACGACCTCCCACTTCGCTTTGTGCAAATCAAGAGAATATT
ATGGATGCGCTAAGTGTCAGATACGTATAGGGCATATTTATCAACTTTACACGCCTATCCACACCGATCTAATAACCTTGAAAAAGAGCAGGCGACCGAC
CAACTATATAAATTAGTTTACAGAGCCTCGCAAAATACGAATCCGTGCTCATACTACAGGTATCGTCGACACACAGTGCTGCTGGAGATCGCGCGGCCTT
TCACAGCTTAACCCTTGCTGCGTACAAAGGTGAAATGAGACCGTACGTTAGATAATTGTGGGCTCTGTCAACGCAAATATGTAACAGTAGATAATTCTAC
TTCTTTCGATCGATAGTATCACGGTAAATGCTCGGGATCGTGCTTGCCTAACGGCAAGGGTTCACCAAAGTGAAGGTTGTGCGGTGTGAATAATTGTAAC
AGCTGCGTCTCGTAAAACTTGCATTCAAGGTTTTTGTCAATTCACCAGGAGACAAAGCACTTCACACGTCATTCTTACCGACTACCCATATTTTTGTCGT
CTACTTCTTAGTGTGCTTATGACTCATTACGCGGTAGAGCTGTCAATGGCGTTGAATATAGACTTAGAATTTATATGGATAAACACTACATCTCATCGAA
AGATAAAGACGTCCGGCAAATTATTGTGCAGTATGGTGGTGAAGGCGGCATTCTTTTTGGTGCCCAGGGCGGCGCAAAGAAGTAGGAGATAGATGGATGA
GCTTCAGCTACGATAGTCTGGCTGCGAGTAAGTCGCGTGCACTGATGGTTCGAGCAATAGACGTTCATTGCATAGGTCTAGTCCCTTGCACCTACTAGTG
ATAAAGGAATTTTACATGAACAGCTGCATTTCCGAGTCCTTCGAACAGTAGCAGGGTAGGTATCACACATTAACTGTATGCCGGTTAACTGTAAGCCTTT
ATTTTGTCCAATGTGTCAGGTCGGTTTACTCCTCAATCATACTCGATGTGCGTGTCGCGAATCGATTGGCTGCAATGCAATCACCTGAATTGCGTAATCA
AGTTTGGAAACTCGTTCGCCGCCCGTTTAACAGCTGCACGATGATGGCGAATTGTAGCACCAACAATCTTAAATTTACTGGTCTCGCTGTTGTCTATCGG
AAAAGATTATCAGTAGATCCTGCGAAAGCAACATAGCCAGCACTAAAGAAGTCGACGTCTTATTTTCCCCGGGTGCTTAAGATGGTGTTGCTGTTTATTT
CATTGTAGCGTTTGTCTATGTACAATAGCAGGTCAGTGTCAGGGCTATATTTTGTCATCAGTTCTTGTCCCGCCTGACCCCCCCCCCGTCGAATTCTCTC
CCACGTCACCGTGCACTTAAGCAGACAATCCTTTGATGTCGAAAAGTATAATGACTCAGGGGAACCTTCATCCCGACATATAATGCGTGAAGATCGGATA
TGTCTGAACACTTGCTGTACCGTGTTCATAACAGAAATTAGCTCTTGTACTCATTTAGACGAGCACTAGACATCACATTTCCATTCAAGAATATCGCGTT
TC