Description :
From Genome Similarity Track
Location :
Scaffold_955:4387- 6682
Transcript NameFunction/comments
Phyag_g8857autophagy-related protein 7

Sequence
2295 bases(100 bases per row)
CCACCCTAGATCAtatcgccgtcttcgtcgctgtcctcgaGGTCAATCATAAGTGAATCAGCCTCTTCCGTCAGCTGGTTTAAGCCTGTGAGCCCCTCCA
AATAAGCAGTAGAGTTGCACGCTTTCTCCAATAGATCGAATGCACCAACAGCATACGCATCCAACACCTTGGAGCTGCACGCAATGCACTTGTTGAACGC
CTCGCCTGTGATCACCATGTTCTGGAAAGCATTGAGAAAACCCCGAAGCTGGTGCGGTATATAGCCCATGGGGACGCTTCCATCGCTTGGCTTTTCAGCA
CCCACATATTTTCCTTTAGGCGAATGcaacacagcaacaagaagttcgactgccgtcgctgctgcaatcgGAGCAAGGCCTGGTCGGGTTACAGTACACA
TTTGATCCAATGTGCGGTCTTTCATCGAGTCGCGAGGACTTACTATGTCGTTACAGAAGTAGCAGCCGAGCGAGGTTTTAGCTGCGACTCCATTTTCACC
GTCAAGATGAACTCCATGACGCATCACTAGGTAGCTGTCAAAGCCAAGCGCCGCATTGAGAAgaagtttcttcttcgacgaggCGATCACAGTCGGAAGC
CAACGACTTTCACGAGAATCCGTTCCCAAAAAAATGACATCGTGTGACTCGATAAGCTGATCCAGTGTCTCCAGACCCTTTCTGGCCTCCTCTATTAACC
GCGGGCTGCTGAGCGCGTGACCTGCCATCGGAATAGTAAGATGCACCGCTTGAGAATTCACACGCGGGAAAATACGCATTAAAGCGTTTGCAGCGCATTC
ACCCTTCGGTTTTCCGACGTCATTAAACTCAAACAGAGGCTGACGTACTGGATTTGAGTGGCTCACCGTGGAGTTATCGACGAATGTAATGTTGCGAAAG
CCCCACGAGAGTAGGCTGCGTGCAGTGTAACAGCCGAGAGTCCCTGCTCCGAGTAGCAAACACTTGGTCTGAGCAAGCAACTCTAAGTCGAGAGATGGGA
GCTGTCGCCACCGCATCAGCTTCAGATTCAAGTCCACCGAAGTTTCCGCAAGGCGGATAGGATCCAAGATACCACCAAGCTCCATCATTCGCGGACCCAG
CTTGCCGCGAACATTGGCTTCCCAGCCTATAACACGCACGTCCTGACGGGATCGGTCGTTTGCCATGAACGATTGGTCACTTTTGATCTCGAACACCACA
GAGCTCTTCCACTCGAAGTCATCAGGAACTTCGGTAAATTGATGCACGTGCTCACGGAAGGAGATGATCTTAACCGGGCGTGAGCAATTCACTTTCTCGG
TTGATAGCGCCGTGAGAAGCGCCAGGAAATTACGCAGAGGCCACCCCGGATTAGTCTTCAGCGGGCACGGGTCCACGAAGCCGAAAAGTGTCTCCACCAC
GTCAGTCGTGCTGTGTTCATCTTTCCTCCACGTCTGCACGTCCAAAACTCTGACGACCTGTTCACTGTTTGTACCTTCAGCCAGCCGCTCCACAACGAAA
AATGGTGCAAAGTTCCCCTCCACAGCACCAGTCGTACTATTCACACGACGCAATTCCAACAAACCTCGAAGTGCATACACCTGCTCCTTAGCTGACAACA
CCGAGGACACCGACACCGGCGGATCTCGATACTTGAACGGCGCCGGCGGAGACAACGCTGGGAAACCGAACCAATACAGGAACGAGTGTTTCTTCAGGTC
GGCAAAAGTGACCAGGACGAAGCTGTTGAGAAGGTCGATTGGAAAGTCCTCGTTTTCACCCCCAAGGACCAGATCCAAGATCTTCTCCCCAGCatctcga
agcagcttggccttgtccagcgtcttgaacgcctgcaacaacaaaatatAATATTAAAAAGTTAGTAAGTGCAGGATAACAACACATCCAGCTCACCGCT
ACCACGTTACCTCTAACGTGTTTGTATTGAACAGCAACCCAGGAGCTTGCCATTCGTATCGAGCACGATCGGTGTTCCTACCCAAGACGATAAAGTATGA
GAATCTTCATGTAGGGATAAGGTGAGCTATAAGCCGCACCTGCCGCTCCCCTGAGCCCCTTCAGCACTTGGGAACGCGCTCTCGTCGATGGTGAAGCGGG
CGGGGACGTTCACCGACCTTCCGGGCGTGAAATAGCCCGTTATTTCCTGCACACAATTGAAAAATTAGAggtttttttattttttcgTTGGACCTGACCT
ACCTGCGCCTGGTCGTCCAGCTGGAACTTGTCGAGCTTGAGCGACGTGAGCGTCTGCCAGAAGGACACGTCGGGTGCGCTGTTCCACGgctggaa