Description :
From Genome Similarity Track
Location :
Scaffold_397:438652- 445401
Transcript NameFunction/comments
Aphin_H310_09882glycosyltransferase

Sequence
6749 bases(100 bases per row)
GCAGGCGTCGAAAAACTACTTTAATTTGGAATCCGACATGAAGCGTCAAAGCTCAATGATGGATGCGGACAACCGATTTAGCCAACGCTTGTCCATGATG
AACGTGCTCCCAGGAAAGCAAGCTGCCTTTCAGGATGAGCCGTCGATCGACTACTGTTGCGAAATCCTTCAAGCAAAGTTCGGGTTCCAACAAGGGTCGG
TCGACAATCAGCGCGAACACGTCTTACTCCTGTTGGCAAACTGCGCAGCTCGTGCGAATTCAGGCAGCACCGACAACACGACACATCATGTGCGACTACT
GCACGATAAACTATTCGGTAACTACAAGGAATGGTGCGCGTTTGTCGGTGCGAAGCCCGTCGCGTACGCGCAAACTCAAGGAGGGACGCCGCTCACGTCT
GTTTTGCACATGGACTTGATGCTGTACTTTTTGATCTGGGGTGAGTCGGCCAACTTGCGTCACATGCCGGAATGTCTGTGCTACTTGTACCATCAAATGA
TGTCGACGCTCATCAAGGAAGCTCTACATTCGGAAGGACGTCCTGCAGGCTGGTTTCTCAACGCAGTGCTGCGTCCTGTATGGAAAGAAGCGTCGGTGAT
GCAAAAGAAGAATGCGCTCGGGAAGCACTTGGAGCATACCAAAGTTCGCAACTACGACGACTTGAACGAATTCTTTTGGCGGTCTGGGTGCCTCAAGATA
CCCATCGACAAAATTGGTGGCGCGCTGCATTCGACTGCTGGGAAGACGTTTTACGAACACCGAAGCATCTTCACACTCGTGCTCAACTACTACCGCATCT
TCCACTTCAACTTCATGTTTTTGATCGTGTTGGCCGTGCTCAACTACGCCGTCACGGTCAGTCCGAACGGTGGCAAGACCGGGTTGAACCAGTTCAGCAA
GATTGGGACCGTCATTGCACCGTACACAAAGCGCGATCTGAACAAAGCGTGGGCCGTGCTCATCGGGTCGCATGCGTTTTTAAACCTGTTCAAGTGCTTC
CTCGAAGTTGGCCATGGCTTTCAGTTGCTCACGGACCCCAAGTCGAAGGCGTCGACTTCGTCGCGTTCCATGACGTATGGGCTGGCGCTGACGCTGCGAC
TCGTGTGGAACCTTGTGTTTACGGGTGCGTTTGCCCTCATGTTTTCGCTTGGCGCGCCCAAGTCGTCGGGTGGATTTGACTTGCTCAACTTACTCAGTGT
TGCGGCGCTCGTGTACCTTGTTCCAGGGGCAATTATCTTGGTCCTGCAGACGTTTTTCCCTGGCACTGGCCGATCGTGGTTTTCAAAGTTCATTCGTGAG
GGTGACAGCTGCTACACAGGTCGTCACATGGCACCGCCGCTTGCATTCCAGCTCAAGTACTATTTGTTTTGGTTTGTGCTGCTCGTGTGCAAGGCTGCCG
TGTCATACTGGGTGCTTGTGAGTCCGCTCGTGTTGCCGAGTCTAGCGATTTGGGAAATGGAGCTCAAGTATGGCCAGGGATCGCTGGGGTCGTTCCACAA
CCTCGGTGTGATTGTCAGCTTGTGGGCCCCCGTCGTGTTCATTTTCAACTACGACACGCAAATCTACTTTACCATTTTCCAAGCTGGTCTTGGCGCGTTC
ATGGGCTGGATGATGAAAGTCGGCGAAGTTCGCGGGGTCGACGCGTTGTCGAAAGCTTTCCGAGTCGCGCCGCAGTTGTTTGACACAAAAGTTGTGACGG
AACTCGCTCGCCTCGCTGATGCCAACGAAGGTGGCGACGAGCATGGCCGCGGCAGCCAGTCGGCGGTGTACCAGTCCCAAATGATGCTTCGGTACGTGTT
TGAAATATTGGGTAGATGGCCGACTGGATGCGTTGTAGTTTTGTAGTCGTGTGGAACGAAATTGTCAACTCGTTCCGCGAAGGCGATTTGGTCGATGACA
AGGAAGCTGCGATTTTGCAATACGACATCCAAAACACGGGCGAAGTGTTTGAGCCGGTGTTTTTGTCGGCGGGCAAGTTGAACGAAGGCATGGCGTATGC
GGTCAAATTGGGCAAGGCTGGTCGCGGCGACTCGGAGCTGCGCATTCAGTTGGTCCAAAACGACTGTCTCGGGGCTGTCAAGTCGTTTTTCAACGCGTCG
ATGTACGTGCTGGAAGCGCTCTTGGCCCCTGACGACACAGAAACGTTGGACGGATTCCGATTGATGGAGCAAGCTGCGCTCGATGGCCAATTCTTGTCGC
TCTTTGATGCTGGGTCCCTTCTCCATGTGCGCACGATGGCCATTGACTTTCTTGAAGCCGTGCTCGACTTGCCAGACCCAGATTCGGTCAGCCCCGTCCT
CAAGACAACGGTGCACCCCATGGGCGTTATTCGCAACTTTGTCGCAAAGATGGACAATTTGTTGAACGGGCTGCGCCTCTTTTGCCGTCAACCTGCCATG
GCAGCCAAGTTTCAAAACGTAAACTTTGTGTCGCCGGCCAACTCGTATGCGTATGCCGCCAAGGGGTTGGTAAATTTGTTTCACTCGGACACGGCCATGG
GTGCCGCCACGCGCGCATACTTGCTCATGTCGTTGGATCGTCAAGACGCCATGCCCAAGTGTGGCGAAGCGCAGCGTCGCCTCGGTTTCTTTATGCAGTC
GCTGTTGATGGAGATTCCGCAGTTGAGCGCGATTCGCAGCATGCGGTCGTTTTCTGTCGTGACGCCGTTTTACAGCGAAGGGGTGATCTTTTCGCTGGAC
GAACTCAACAACCCTCTGGAGAACCACCCGATTTTCAACAAGGCATCGGAAATCGACAAGAAGATTACGATTCTAAAGTACTTGATCACGATTCACCCGG
AAGAGTGGGAAAATTTTCTGGAACGCATTGACGTGTCGACGGTCGATGCCGCGATCAACGAGTACCCGATGGAACTCCGTTTGTGGGCGTCGTATCGCGG
TCAAACGCTGGCGCGCACGGTGCAAGGCATGATGCTCTATGAAGACGCGATCAAAATCCTGCACTGGCTCGAGATTGGGTCGTCCCCGAACCGCACGCCC
GAGCAAAAACAACAGCAATTGGAAGATATGATCCGACTCAAATTTTCCTACGTATGTGCGTGTCAAGTGTATGGGAAGCACCGCGCGGAAAATGCCGACC
AAGCGAACGATATTGACTTTTTGCTCCAAACGTATCCGAATTTGCGCGTGGCGTACGTGGACACAATTCCGGGCGCGAACGGCGCGCCGAATCGATACGA
AACAGTCTTGATCAAGTCGGAAGGCGACGAGATTGCCGAGGTGTATCGGTGGGAGCTGCCTGGTGATCCGATTTTGGGCGAGGGCAAGCCGGAAAACCAA
AACAATGCGCTCCCGTTTACGCGCGGCGAATACGTTCAAACGATCGACATGAACCAACAACATTACTTTGAAGAGTGCTTGAAGATGCCACAGCTCCTCG
TGACGGCCGATCAACATCCGAGTAGACTGCCTGTGACGATCATTGGGATGCGCGAGCATATTTTCACGGGCAATGCGTCGTCGCTGGCCAAGTTCAAGAC
GTGGCAGGAGCTCGTGTTTGTGACTCTGAGTCAGCGCGTGCTGGCGAATCCGTTGTATGTGCGCATGCATTACGGCCATCCCGATATCTTTGACAAGGTG
ATGGTGCTCACGCGCGGTGGGGTGTCGAAAGCGTCGAAGGGCATCAACTTGAGTGAAGACGTGTTTGCCGGGTTCAACTCGACGTTGCGTGGCGGCGTCG
TCACCCACGTCGAGTTTATGCAGTGCGGGAAGGGCCGCGATGTCGCGATGTCGCAAATTTCGATGTTTGAGGGCAAGTTGGCGAACGGCGCCGGCGAGAC
GTCGCTGGCCCGCGAAGCGTACCGCATGGGCGCCTTTATGGACTTTTTCCGCCTCAAGTCGATGTACTATTCGCACACGGGGTTTTACTTTGCCACGTGG
CTCACGATTGTGACGTCGTACGTGTACATTTACGCCAAGGTGTACTTGGCGCTCTCGGGAGTTCAAGTGCAAGTGGTCGAAAAGATGAACTCGACCCAAG
TCATTTCGCTCAATGCGTACCAGCACGGCTTTGACACGCGTGTGTACAACGATCTGGACAGCGTCATGAACACGCAGTACATTATCCAGGCCGGTCTGTT
TTTGACGCTGCCGCTGATTGTCGTGTACTTTGCGGAACTGGGCTTGATTGGGGGTGTGACGAAGCTCCTGAACATGATTTTGACTGCCGGTCCAGCTTTT
TTCGTGTTTCAAGTCGGCACGACGATGCACTACTTTGACAACAACATCATGCACGGCAATGCCAAGTACCAAGCAACGGGTCGTGGGTTCAAGATCACGC
GGGAGACGTTTGTGTTGCTGTACAAGGCATATTCGACGTCGCATTACCGCAAAGCGTGGGAGTTGGTTGGGCTGTGCATGCTCTACTTGTCGTATGGCAG
CTTCAACATTTGCAACCGCACGCCCGACCCGAACCGTCCGGACGACCAGTTTGCATCCAAGTTTTGCGACACTGCGCAGGGGTACGGCACGCAAACGTTT
GCCATTTGGTCGATTGCGATTCTGTGGCTGTTGTCGCCGTTCATTTTCAACGCGGACGGGTTGGACTATGAAAAGACCAAGGCCGACATTGTGGCGTGGT
GCAAGTGGATGTTTATGGACGAAAAGGCGACCGACCCCGACAAGGTGCACACTGGTGGGTGGATTGCGTGGTGGAAGAGTGACCAAGAACAGTTCTACGC
CACAACAGGCATCGCGCGCCTCACGGTACTCTTGCGCGAATCTCGCCATTTCCTGATCATGTGGTACGTTATCACTCTCCGTCTCGAAGCCAAGTATGTG
CTCTTCACGCTGGCGGCGGCGGTGGCGACCTTGGTGGTGCTGTATGTATTCCACGTGCTGGGGCTAGCGCTGCGCAAGGCGGCGTTTTTGGGTCGTGCCG
CGCTGTACCTGTTTTTGCTCTTGCTTTTTGTCGCGGGCAGCTTTGTCGCGATGAATCTGGTCCTGTTCAAGTCAAAGAAGAGCGACGAGGCGTGGGACAA
TAGCTTGTGTTTGTTTTACGGGTACTGCGCCGCCTTGTACGGGATCAACGAGATGCTTCGCGTGGCCAACTTTAAGGGCATGCCTGTGCACAACGTAGCG
GTGGTCGCGCAACTGGCGTTCTTTTTCGACTTCATCTTTGGCGCGTTGCTGCTGCTACCGCTGCTTGTGCTCAGTTGCATCCCGTTCATGAACGCGATCC
AAACGCGCATGATGTTCAATGAAGGGTTTTCGAAAGCGGTGTCTGCGTCGTCGCAACATGCATTTTCCCTCGCCGCGGCCCTCGGTGCGTTGGTCGGAGT
CGCCTCGGGCTGGCTCTACTACATGCTCTTGTCGGTGGACTTGGCTCCTGGCTACAGCATTTACCTGACAACGTACAAGCTGACGTCGGTGGTGGCCGGA
AAAGGCTTGACGTCGTACATTGCGTTGGCTGGATCGGTGGTTGGGTCGATCCTGACTAGCTTTATGGGCTACGCCTTGGGTCACCGCATGACGGTGCTCA
TTGCAGGTGTGCTGAGCGTGTTGGGCTGCTTGGCGCTGAGTTTTATTCCGTCGTTGGCCCCCAAGACTGGGTCGCAGTCGCCGGCCGTGTTGTTTGGTGG
CATTGGGCTCTTGTCTGTGTCGTTGGGCATGATGCTGCCTGCCGTGTCGTGCTATATTTACGAAATCTCGACCTACGACATGCGCTCCAAGACGATGCTG
CCGTTTGCGTTTGCCTTTGTCGTGGGCACGGCCATCTCGTCGTATTATTCTGGTGGTGCTGTCGGTTGGGTGTGGCAATCATTTTGGTGCGCGCTGCTCA
TGGCGCTTGTCACGCCGCTGATGAACATGTTTCCCGAATCGCCACAATGGGTGCTCGAGCGCAAGGGCTATGAAGAGTGCGAGACTGCGCTCAGCATTTT
ACGTCAACGCCCGGAAAATGCCGCCGAACTGCGCGAACTCCGCGAAGACCAAGCCCACGCAAAGAAGGACAATGACGGTGGGTCGTCGGCGTACAAGGTG
GCGCTGTCGATGTTGTGCATGATCATTTCGTCGCTGTCGGTGGGATCGCTCAATGTGTTTGTCGCGCGCACATTTACGACCTTTGCCGACGACAACTTGG
TCTTTACAAACGCATTGGTGGTGGAAGCGTCTGGCGTGCTCGTGAGTTTTTTCCTCATGGACAAGTGGCCCCACCGCAACCTACTCGCGTTTACGCTGCT
CGGCGTCGGGCTGTGCGCCGGCGCGCTCGGCGCCGACGACGTGTCTCCGTTTTTGGAAACCAACAAGAACCGCAAGCTCATCACGTCGTTGTTTATGTAC
GTGATGTTCTTCATCAAGGGCCTCGGCATCTCGTCGACGGTGTGGGTGAACGTGACGGGTTTGTTTGCGGCCAAGTCGCGATTCTTTGCCGTGCCGCTGT
TGTTTGGTCTGTGGTTTGCCGTCCCTGCCGGCAGCGTCGCCCTTCGCGTGTCGAGTTTTACCAAGAACGCGTACTTGTGGTTGTTTGCGTTGGCAGGGCT
GTGCTTGATCACGCTGTTTTTGGTCGTGATGGCGTCGAACCGCGCCAACGGACTCGTTTGCACACGCACCGACATGAAGAAGGACAAAGCGCGTCGCGAC
CGGCTGCGAGGGTCGCGGCACTCGCGCACCCCCGGCAGCTTTAGCCGCAACCGCCGTCAATCGCGGTCGGCGCGCCAGTCGCGGTCCAACTCGATGGCGA
AATCGTTTCAAGGCAGCTATCAGTTGGTCGCGTCGCCCAGCGCCAATGC