Description :
From Genome Similarity Track
Location :
Scaffold_1249:4386- 6404
Transcript NameFunction/comments
g16520.t1hypothetical protein

Sequence
2018 bases(100 bases per row)
TTTGATGCCACAGGGTGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCGTTCTGGGAATCTACCCACAAGCTACCGA
TCACTAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTACGTTTTGGCTCGGGTGCAAGCAGCGTCGATCTCGAGCTGGTCCTCGGTGGCAGACCGTCCT
CAAGAATTTACTGGCGGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAAAGGTGTTTT
TGGTACCCTGGCCTTGGAGCCACGCGGGCGCCCCCTGACTTGATCAACGCTCTTCCTACCGCAGATTCTGCCGACCCGTGGCGCAACCAATATTGCACAC
AACTGGGCGATCATCCCGGGTCCCGCATCGCACGTCTGGACGGTAAGTTTCGGTCCGTCGTCGACTCTGAGTGAAATAACCCTCTCCAAGGTCTTGATAA
GCTTCTGCAATACATTCTTTCTCTTCTCTTTCCCTCTTTATGGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCACAATTCACAA
ATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACACTACCTGTTACTGCAGGGGGCTTTCCGCTTTCCCTTCCT
GGGACTGCATCGCTTGGAATCTGTTCCGGCTGGCCAGTTCTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGCCCGCCTCATCGACCCAAGTTGG
ATCGTCGTAACCCTTCCAGAACTCCAGAAAATCTCGGTGGACTCGTCCATAGCGCGTCCGGCGGCCAGTTCTCACATCCGCGATCTTCTCCACTTCAAAC
TCGCCTTCGTCGAGTGGGGTCTCCCAACTGTCTTCCAGCAGGAGGGCTTCATCGAAGTCCAGGCGATCGCTCTCGGTCACAAACAACGACGTGTCAGGAC
GATCGGGGAATCTCCGGACCAACTTCAGTTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAGCCCGCGATCTCAAGACGTGCGGCGTGATCGCC
GATCATTTCAGCGACCCGAAAAGGTCCATACCACAGGTGTGCGAGCTTTCGTGCATACCCTTCCTTGACTCGATCGAGGTGCAGCCATACCTATTGTGGG
GTCGCAGATCTTCGTTGTGCCGGTTGGCTCTACCTCTGATCGCCTCCCGCAGTCGCTCGCGGACCTGTTCCAGCGCTCGCTGATAGTGTCCTTGTACATG
GTATCTCCACTGACGGGGCTCCTGATCGCGCCGGTGCGTGCTGCCTAACGGTAGTGTTGCCTCCAGCGTCGATCGCGGGTCCCATCCATGGTCCAGGTAG
AAGGGCGTGTCTCCACGAACTCAATCCTGGGCCGTGTTCAAAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGT
ACATCTTCAGCGATCGCGTTAGAGTCTGCACCATTTGTTCGGTAGTCTCGTTAGCTTGTGGGCGGTACGCCATCGTACCTCTCTGTTTCTGACCCACTAT
CCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATATCGGATGACTTCACTGGCGCCGAAACATCGAAAGACGCATTCCTCGTGG
TTCTCGGCGATCGTTTGGGCACGCTTGCCTTCGCGATCACGTATCCGGTGAAAAGGTCGACCCAGATTAACAGCTCTGTGTTCCCTTTGTACGACTTCGG
TAGAGACGGAATGTGGTCCATGGCAATCATTTGGAATGGGTACGTAGCTTGTACATTCCCAGGCGACTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTT
TCACAACCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCTCTCTCCAGTGGATAGCGCCTTGACACGCTGGTAAGTCCTCCCGATCCCTTG
GTGCCCGCCTTCCAGGCT