Description :
From Genome Similarity Track
Location :
Scaffold_404:4386- 5698
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_404-abinit-gene-0.31Myosin

Sequence
1312 bases(100 bases per row)
CAACAAGGTGAACCAGACTATTCTCGTGAGTGGTGAGAGTGGTGCTGGTAAAACTGAGACCACGAAATTAATTATGAACTACCTGGCTTACGTCTCGACT
TGCCGAAGCGCAGCAGTCAACAAGAGCAGCGCAGCAAAGGGCCAACCCACGATCCATGACCGTGTGCTTGAGTCGAACCCGATCCTGGAAGCCTTCGGTA
ACGCGCGTACGAACCGCAACAACAACAGTAGTCGGTTCGGAAAGTTCATCAAATTGGGGTTCACATCGACGGGTGAGATGCTTGGGGCTCAGATCTCGAC
CTATTTGCTTGAACGGGTTCGACTTGTGTCGCAGGGCAAGGGCGAACGTAACTACCACATTTTCTACGAGCTGTGCAAAGGTGCTTCCAACGAAGATCGT
GATGCTCTCATCTTGCGGGATGTGACCGAGTACAAGTATTTAAATACTTCCGAGTGTTACATTCGACTCGACGGTGTAGATGATGCGAAATCGTACCAAG
AAACTCGTCACGCGATGACGAGTATTGGCATGGACAACGACGAGCAACTTCATGTGATGAGAGTGGTATCCGCAGTGCTGCATTTGGGAAATATTCACTT
CGTATCAGAGAAGGGCAGGGACTCATCGACAATTGACTCGTCCTCCTCGTCGCTTGAGAGTCTTCAAGCAATCTGCAAGCTTCTTGGCGTCGAGCAGGAA
GTTTTACACAGCACACTGTGCACGAAACAGATCAAGGCAGGCGCCGAGTTTATTACGACGAAATTGACAGTCAGCCAGGCCACTTCGACACGTGACTCGG
TTGTGAAAACGCTCTATTCCAACCTATTCAACTGGCTCGTGGCGCGCATCAACAGCTCGATTCAGTACAAAGAAGAGCGAGGCAGCCAATTTATTGGTGT
TGTCGACATTTTCGGTTTCGAGATTTTTGAAGAGAACTGCTTGGAGCAGCTTTGCATCAACTACGCGAATGAGAAGCTGCAGCAACTCTTCGGCCGGTTT
GTGTTCCGCATGGAGCAAGAAACCTACGTGTCTGAAGATATTCCATGGCAATTTGTGGATTACCCGAACAACGATATCTGCGTGACGATGCTTGAAAGAC
GACAAATGGGTCTTTTCTCACTTCTGGATGAGCAATGTCTGATTCCAAAGGGTAATGATGAGAAGCTGGCGAACAAGTATAACGAACAGTTGCTGAAGGA
GTCGTCGTATTCGGTCTCGAAGTTGCAACGAGCTAAAGGTCAATTTGTCATCCATCACTACGCCGGTGATGTGTGCTACAGCACGAATGGTTTCTGCGAC
AAGAACAAGGAT